View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12174_low_30 (Length: 240)
Name: NF12174_low_30
Description: NF12174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12174_low_30 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 40377154 - 40376931
Alignment:
| Q |
17 |
gctcttctgcagattgatggcaagaagtgtctttcaatgagccacaaattgagcaactctgatgtctaacattttctgtagaatccagtaaaaccttagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40377154 |
gctcttctgcagattgatggcaagaagtgtctttcaatgagccacaaattgagcaactctgatgtctaacattttctgtagaatccagtaaaaccttagc |
40377055 |
T |
 |
| Q |
117 |
taaactgtgatccgaaatccgtcgagttccctcatcagtatcagcattaagtacttttgtattcttactgagtgtcaattgaatcgaaccaagcaaacca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40377054 |
taaactgtgatccgaaatccgtcgagttccctcatcagtatcagcattaagtacttttgtattcttactgagtgtcaattgaatcgaaccaagcaaacca |
40376955 |
T |
 |
| Q |
217 |
tgtgtcaattgaattgaaccaagc |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40376954 |
tgtgtcaattgaattgaaccaagc |
40376931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University