View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12174_low_35 (Length: 229)
Name: NF12174_low_35
Description: NF12174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12174_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 17 - 174
Target Start/End: Original strand, 6909892 - 6910051
Alignment:
| Q |
17 |
atgaatcaggaagaagaagaggttgtaaatgtagaaagagaagaagtataaaaatgaaaatacttttaatttgtatctgatgagatgaatccag--caca |
114 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
6909892 |
atgaatcaggaagaagaagaggttgtacttgtagaaagagaagaagtataaaaatgaaaatacttttaatttgtatgagatgagatgaatccagcacaca |
6909991 |
T |
 |
| Q |
115 |
cgactctgcttcgcgcgtcaacgcaacaaaagtcccccacctaccatattattatcaagt |
174 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6909992 |
cgactctgtttcgcgcgtcaacgcaacaaaagtcccccacctaccatattattatcaagt |
6910051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University