View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12175_high_1 (Length: 367)
Name: NF12175_high_1
Description: NF12175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12175_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 57 - 161
Target Start/End: Original strand, 13473540 - 13473644
Alignment:
| Q |
57 |
ttttcacttcatttccttcaatttccttatagctttcaaaacccatattttattgagtccaccccacgtacctagattaccagctaactcgtttcatcac |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
13473540 |
ttttcacttcatttccttcaatttccttatagctttcaaaacccatattttattgactccaccccacgtacctagattaccaactaactcgttccatcac |
13473639 |
T |
 |
| Q |
157 |
actga |
161 |
Q |
| |
|
||||| |
|
|
| T |
13473640 |
actga |
13473644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 158 - 248
Target Start/End: Original strand, 13473732 - 13473822
Alignment:
| Q |
158 |
ctgaaaattatgaatgctgaagtagtggacgttaaaagtagttacaggcagagagaagagagtatgtagctcgtgagaggaaaccatgttc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13473732 |
ctgaaaattatgaatgctgaagtagtggacgttaaaagtagttacagccagagagaagagagtatgtagctcgtgagaggaaaccatgttc |
13473822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 274 - 353
Target Start/End: Original strand, 13473877 - 13473956
Alignment:
| Q |
274 |
tgttgttaagttataatgttatgtgtatggtttttggtttagtctcacgggaatccagccacccctctcactcactcaca |
353 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13473877 |
tgttattaagttataatgttatgtgtatggtttttggtttggtctcacgggaatccagccacccctctcactcactcaca |
13473956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 13473451 - 13473491
Alignment:
| Q |
19 |
ttatgaatcacatgacctcttctttcaatgcaatttatttt |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13473451 |
ttatgaatcacatgacctcttctttcaatgcaatttatttt |
13473491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University