View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12176_high_1 (Length: 341)
Name: NF12176_high_1
Description: NF12176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12176_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 131 - 323
Target Start/End: Original strand, 2517584 - 2517776
Alignment:
| Q |
131 |
gatgggaaaattatataaaagcaatgaactttcagttcctaataagtacatgactcattcaatattggttcttttccaaaccaaagcaggctgaacaaaa |
230 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2517584 |
gatgggaagattatataaaagcaatgaactttcagttcctaataagtacatgactcattcaatattggttcttttccaaaccaaagcaggctgaacaaaa |
2517683 |
T |
|
| Q |
231 |
gaagaaaacggaaaaagaatgtaggaccaaacagccagcagatactaaacaaagaaaggagtcatttagcacatgaaaacatcataacttaag |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2517684 |
gaagaaaacggaaaaagaatgtaggaccaaacagccagcagatactaaacaaagaaaggagtcatttagcacatgaaaacatcataacttaag |
2517776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University