View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12176_high_4 (Length: 212)
Name: NF12176_high_4
Description: NF12176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12176_high_4 |
 |  |
|
| [»] chr5 (183 HSPs) |
 |  |
|
| [»] chr8 (194 HSPs) |
 |  |
|
| [»] chr7 (203 HSPs) |
 |  |
|
| [»] chr4 (235 HSPs) |
 |  |
|
| [»] chr3 (261 HSPs) |
 |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |
|
| [»] scaffold0005 (5 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0166 (2 HSPs) |
 |  |  |
|
| [»] scaffold0105 (2 HSPs) |
 |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0684 (2 HSPs) |
 |  |  |
|
| [»] scaffold0176 (3 HSPs) |
 |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |
|
| [»] scaffold0011 (3 HSPs) |
 |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0106 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 9e-29; HSPs: 196)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 146 - 210
Target Start/End: Complemental strand, 38980262 - 38980198
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38980262 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38980198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 37271732 - 37271794
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37271732 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37271794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 24483894 - 24483834
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24483894 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
24483834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 33732860 - 33732919
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33732860 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
33732919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 17541375 - 17541437
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17541375 |
aaataaaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
17541437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 26814232 - 26814174
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26814232 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26814174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 41693665 - 41693731
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41693665 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
41693731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 11713853 - 11713788
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11713853 |
aaaaaaaaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
11713788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 16900208 - 16900151
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16900208 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16900151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 16993599 - 16993542
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16993599 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16993542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 19184153 - 19184096
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19184153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19184096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 37272104 - 37272047
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37272104 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37272047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 8046326 - 8046386
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046326 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgta |
8046386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 2481559 - 2481500
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2481559 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
2481500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 4423893 - 4423952
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4423893 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
4423952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 16522989 - 16523048
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16522989 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
16523048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 22881611 - 22881670
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22881611 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
22881670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 149 - 212
Target Start/End: Original strand, 27310870 - 27310932
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27310870 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctgta |
27310932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 29859874 - 29859815
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29859874 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
29859815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 38731827 - 38731886
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38731827 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
38731886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 42358697 - 42358756
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358697 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
42358756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 44985623 - 44985678
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
44985678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 9195207 - 9195149
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9195207 |
aggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgta |
9195149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 11788417 - 11788359
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11788417 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
11788359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 16523326 - 16523268
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16523326 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
16523268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 19183779 - 19183837
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19183779 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19183837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 40302340 - 40302282
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40302340 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgta |
40302282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 43592045 - 43592103
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43592045 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
43592103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 43597153 - 43597211
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43597153 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgta |
43597211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 8046648 - 8046591
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
8046591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 11713485 - 11713542
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
11713542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 14003744 - 14003687
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003744 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 15842825 - 15842768
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15842825 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 36622250 - 36622307
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
36622307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 41694003 - 41693946
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
41693946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 43788857 - 43788910
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43788857 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43788910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 44073809 - 44073752
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44073809 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
44073752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 155 - 211
Target Start/End: Complemental strand, 3671192 - 3671136
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3671136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 3838263 - 3838207
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
3838207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 4424192 - 4424128
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4424192 |
aaatcaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
4424128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 10374775 - 10374831
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
10374831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 24358615 - 24358671
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24358615 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 25705082 - 25705142
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25705082 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
25705142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 25705450 - 25705394
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25705450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 29865222 - 29865278
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29865278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 40301972 - 40302032
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
40301972 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgta |
40302032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 5334751 - 5334806
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 5335040 - 5334985
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 5790558 - 5790613
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
5790613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 18113087 - 18113146
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18113087 |
aaggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgta |
18113146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 20131681 - 20131626
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 24358953 - 24358890
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24358953 |
aaaatgaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 26813866 - 26813921
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26813921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 27311070 - 27311015
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27311070 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 2265406 - 2265340
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
2265406 |
aaaaattaaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgta |
2265340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 10671942 - 10671884
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
10671942 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
10671884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 13215059 - 13215117
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13215059 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13215117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 20658060 - 20658118
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20658060 |
aggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgta |
20658118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 29865512 - 29865454
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29865512 |
aggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgta |
29865454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 30215419 - 30215477
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30215419 |
aaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 33733241 - 33733187
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 44559061 - 44559119
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44559061 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
44559119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 44985985 - 44985927
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44985985 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgta |
44985927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 1497610 - 1497667
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgta |
1497667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 3671002 - 3671059
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
3671002 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt |
3671059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 7814244 - 7814301
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7814244 |
aaggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg |
7814301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 211
Target Start/End: Complemental strand, 7814738 - 7814681
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7814738 |
aggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
7814681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 9195054 - 9195111
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
9195111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 10375069 - 10375012
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgta |
10375012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 12835325 - 12835382
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgta |
12835382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 20939333 - 20939268
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| || |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20939333 |
aaaattaacgctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
20939268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 31226077 - 31226020
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgta |
31226020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 31644837 - 31644898
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
31644837 |
taaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgta |
31644898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 33576119 - 33576062
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33576119 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 34317798 - 34317855
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
34317855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 43597507 - 43597442
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
43597507 |
aaaattaaggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgta |
43597442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 43789194 - 43789137
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43789194 |
aaggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg |
43789137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 14003408 - 14003464
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14003408 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 16673772 - 16673716
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16673772 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 20131316 - 20131372
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20131316 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 23989837 - 23989889
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23989837 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 24483401 - 24483457
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgta |
24483457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 26238810 - 26238870
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
26238810 |
aaaggttaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
26238870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 26239161 - 26239105
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
26239161 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 31326255 - 31326195
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31326255 |
aaaggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgta |
31326195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 38639411 - 38639463
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38639411 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 41451836 - 41451892
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41451836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 1137983 - 1138038
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgta |
1138038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 3837931 - 3837990
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3837931 |
aaggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgta |
3837990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 152 - 207
Target Start/End: Original strand, 4042607 - 4042662
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4042607 |
aaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 16968550 - 16968609
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
16968550 |
aaggttaaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgta |
16968609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 17302145 - 17302086
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17302145 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgta |
17302086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 25954428 - 25954369
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
25954428 |
aaggttaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgta |
25954369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 31225713 - 31225772
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
31225713 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgta |
31225772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 32476093 - 32476152
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32476093 |
aaggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgta |
32476152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 37911122 - 37911063
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
37911122 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgta |
37911063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 41791020 - 41791075
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgta |
41791075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 43710710 - 43710651
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43710710 |
aaggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgta |
43710651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 146695 - 146633
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
146695 |
ataatggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgta |
146633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 2481186 - 2481248
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||| || | |||||||||| |||||||||||||||||||||| |
|
|
| T |
2481186 |
aaataaaggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 10664983 - 10665041
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
10664983 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgta |
10665041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 10671629 - 10671687
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10671629 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgta |
10671687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 16673408 - 16673466
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16673408 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 207
Target Start/End: Complemental strand, 17541778 - 17541724
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
17541778 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
17541724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 150 - 212
Target Start/End: Original strand, 25954110 - 25954172
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
25954110 |
ataaaggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtccttgta |
25954172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 26707872 - 26707930
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26707872 |
aggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgta |
26707930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 27109073 - 27109127
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 32691312 - 32691370
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32691312 |
aggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgta |
32691370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 40786459 - 40786517
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40786459 |
aggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgta |
40786517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 42695868 - 42695922
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 10665298 - 10665237
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
10665298 |
taaaggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgta |
10665237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 31325920 - 31325977
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgta |
31325977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 152 - 205
Target Start/End: Complemental strand, 36622587 - 36622534
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36622587 |
aaagactaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 36806892 - 36806839
Alignment:
| Q |
159 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
36806839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 37228725 - 37228790
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
37228725 |
aaaaaaaaggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctgta |
37228790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 40124966 - 40125023
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgta |
40125023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 41791312 - 41791255
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtctctgta |
41791255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 42696207 - 42696146
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42696207 |
taaaagctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccatgta |
42696146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 3172017 - 3172077
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
3172017 |
aaaggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtccatgta |
3172077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 3172535 - 3172475
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
3172535 |
aaaggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtccatgta |
3172475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 17912808 - 17912760
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 23732331 - 23732272
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23732331 |
aaaggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctgta |
23732272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 33575751 - 33575807
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33575751 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 43672325 - 43672261
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
43672325 |
aaataaaggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgta |
43672261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 44994064 - 44994004
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
44994064 |
aaaggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtctctgta |
44994004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 36815837 - 36815778
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
36815837 |
aaggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgta |
36815778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 40125291 - 40125232
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
40125291 |
aaggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgta |
40125232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 43671932 - 43671991
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
43671932 |
aaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgta |
43671991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 44559407 - 44559352
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgta |
44559352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 1138360 - 1138302
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
1138360 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgta |
1138302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 30215872 - 30215814
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
30215872 |
aggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgta |
30215814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 31909479 - 31909422
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
31909479 |
aggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtctctgta |
31909422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
| Q |
161 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 207
Target Start/End: Complemental strand, 45442698 - 45442644
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
45442698 |
aaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 18113454 - 18113397
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |||||||||||||| |||||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgta |
18113397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 34318083 - 34318026
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||| ||||||||| |||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtccttgta |
34318026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 34964159 - 34964102
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgta |
34964102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 4042890 - 4042838
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 206
Target Start/End: Original strand, 17912452 - 17912500
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
17912500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 35155622 - 35155562
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| || |||||| |||||||||||||| |
|
|
| T |
35155622 |
aaaggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgta |
35155562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 38979889 - 38979945
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatat-gcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctg |
38979945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 13850881 - 13850827
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| || ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtctctgta |
13850827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 37910755 - 37910813
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| |||| ||||||||||||||| |
|
|
| T |
37910755 |
aggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgta |
37910813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 20658410 - 20658350
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg--gttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20658410 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttttagtccctgta |
20658350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 23732039 - 23732096
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccatgta |
23732096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 4794468 - 4794416
Alignment:
| Q |
160 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtctctgta |
4794416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 13215366 - 13215318
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
13215366 |
aggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 26709695 - 26709747
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
26709695 |
aggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 196
Target Start/End: Complemental strand, 32691638 - 32691594
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
196 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
32691638 |
aaaggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 14393130 - 14393072
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
14393130 |
aaggctaaaatatgattt-agttcctgcaaatatgtctcgttttggttttagtccatgta |
14393072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 203
Target Start/End: Complemental strand, 16900135 - 16900100
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16900100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 203
Target Start/End: Complemental strand, 16993526 - 16993491
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16993491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 19831506 - 19831565
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
19831506 |
aaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgta |
19831565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 212
Target Start/End: Complemental strand, 22881950 - 22881911
Alignment:
| Q |
173 |
gtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccctgta |
22881911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 25299747 - 25299802
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctgta |
25299802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 43592382 - 43592323
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| ||| ||||| ||||||||| |||| |
|
|
| T |
43592382 |
aaggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtccttgta |
43592323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 43710384 - 43710435
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||| ||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
43710384 |
taaaatataattttagtcccttcaaatatgtctcgttttggttttagtccct |
43710435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 44993806 - 44993860
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||||| |||||||||| ||||||||||||||| |||||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggttttactccctgta |
44993860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 1295544 - 1295490
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctgta |
1295490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 203
Target Start/End: Original strand, 13802484 - 13802534
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||||||||||||| | || |||||| |||||||||||||||| |
|
|
| T |
13802484 |
aaggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta |
13802534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 13850521 - 13850579
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
13850521 |
aggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgta |
13850579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 36815487 - 36815545
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
36815487 |
aggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgta |
36815545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 38732130 - 38732076
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| || |||||||||| ||||||||| ||||||||||||||| |||||||| |
|
|
| T |
38732130 |
taaaatttgattttagtcccagcaaatatggctcgttttggttttaatccctgta |
38732076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 212
Target Start/End: Complemental strand, 26708184 - 26708147
Alignment:
| Q |
175 |
ccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26708184 |
ccctgcaaatacgcctcgttttggttttagtccctgta |
26708147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 29182164 - 29182225
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||| || |||||||||||||| ||||| |
|
|
| T |
29182164 |
taaaggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtctctgta |
29182225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 210
Target Start/End: Complemental strand, 33576076 - 33576031
Alignment:
| Q |
165 |
tggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
33576076 |
tggttttagtccctgcaaatatgtctcattttggttttggtccctg |
33576031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 38231431 - 38231488
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
38231431 |
ggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgta |
38231488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 205
Target Start/End: Original strand, 5006605 - 5006657
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
5006605 |
aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5006657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 29182440 - 29182392
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 201
Target Start/End: Original strand, 29831812 - 29831860
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
201 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
29831812 |
aaggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 152 - 183
Target Start/End: Complemental strand, 29311631 - 29311600
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29311631 |
aaaggctaaaatatggttttagtccctgcaaa |
29311600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 35686335 - 35686288
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||| |||||| |||||||| |||||||||||||||| |
|
|
| T |
35686335 |
taaaatatggttttgatccctgtaaatatgcttcgttttggttttagt |
35686288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 37229039 - 37228992
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggttttagt |
37228992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 186
Target Start/End: Original strand, 1777462 - 1777500
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
1777462 |
aaataaaggctaaaatatgtttttggtccctgcaaatat |
1777500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 4423968 - 4424010
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
4423968 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4424010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 4794203 - 4794245
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
4794203 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4794245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 14392791 - 14392845
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| |||||| ||| |||| |
|
|
| T |
14392791 |
taaaatatggttttagtcattgtaaatatgcctcgttttagttttaatccttgta |
14392845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 16523062 - 16523104
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
16523062 |
ttttggtccctgcaaatatgcctcgtttaggttttggtccctg |
16523104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 202
Target Start/End: Original strand, 29831885 - 29831919
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
29831885 |
ttttggtccctgcaaatatgcctcgttttggtttt |
29831919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 11943543 - 11943588
Alignment:
| Q |
160 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||| ||| |||||| ||||||||||||||||| |
|
|
| T |
11943543 |
aaatatggttttagtcaatgcgaatatgtctcgttttggttttagt |
11943588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 152 - 209
Target Start/End: Original strand, 17301981 - 17302036
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||| || |||| |||||| ||||||||||||||||||||| |
|
|
| T |
17301981 |
aaaggctaaaatatggttttggt-cctgaaaatat-tctcgttttggttttagtccct |
17302036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 183
Target Start/End: Complemental strand, 42358872 - 42358843
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42358872 |
aggctaaaatatggttttagtccctgcaaa |
42358843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 208
Target Start/End: Original strand, 1138055 - 1138095
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
1138055 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
1138095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 201
Target Start/End: Complemental strand, 1696457 - 1696409
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
201 |
Q |
| |
|
|||| ||||||||| |||| |||||| |||||||| ||||||||||||| |
|
|
| T |
1696457 |
aaggttaaaatatgattttcgtcccttcaaatatgtctcgttttggttt |
1696409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 2412488 - 2412432
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| | |||| |||||||||||||| |
|
|
| T |
2412488 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
2412432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 25300038 - 25299991
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagt |
25299991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 183)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 149 - 212
Target Start/End: Original strand, 7075566 - 7075629
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7075566 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
7075629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 2217490 - 2217551
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2217490 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
2217551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 26133420 - 26133356
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26133420 |
aaataaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
26133356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 78 - 154
Target Start/End: Complemental strand, 27832885 - 27832809
Alignment:
| Q |
78 |
ttaaaagtttattgagcaattactttatatcagtttttaaaaagtgttatgaacggtcaatcatgaataaaaataaa |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||| |
|
|
| T |
27832885 |
ttaaaagtttattgagcaattactttatatcagtttttaaaaagtgttatgaacaattaattatgaataaaaataaa |
27832809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 28863507 - 28863567
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28863507 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
28863567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 36578086 - 36578026
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36578086 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
36578026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 40029504 - 40029440
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40029504 |
aaataatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
40029440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 149 - 212
Target Start/End: Original strand, 30800488 - 30800551
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30800488 |
aatataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30800551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 5950175 - 5950233
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950175 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
5950233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 18633596 - 18633654
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18633596 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18633654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 29692743 - 29692801
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29692743 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29692801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 30800851 - 30800793
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30800851 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30800793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 35167172 - 35167110
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35167172 |
aaatgaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 28863838 - 28863781
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
28863781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 29172888 - 29172831
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29172888 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 10743721 - 10743781
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10743721 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
10743781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 16038374 - 16038434
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16038374 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
16038434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 155 - 211
Target Start/End: Original strand, 28550827 - 28550883
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28550883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 29875726 - 29875670
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29875726 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29875670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 38170511 - 38170571
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38170511 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
38170571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 40167783 - 40167843
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40167783 |
aaaggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
40167843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 2217855 - 2217800
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
2217800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 10408920 - 10408983
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10408920 |
aaaaaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
10408983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 19685382 - 19685323
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19685382 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
19685323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 38786157 - 38786216
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38786157 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
38786216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 5614531 - 5614473
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5614531 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
5614473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 11799459 - 11799401
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgta |
11799401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 18046349 - 18046291
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18046349 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
18046291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 24443745 - 24443687
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24443745 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
24443687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 29172524 - 29172578
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 35928061 - 35928119
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35928061 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 36577721 - 36577779
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36577721 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
36577779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 40764787 - 40764725
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40764787 |
aaataaaggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 1381613 - 1381556
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1381613 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 5917462 - 5917405
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5917462 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 15635709 - 15635652
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15635709 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
15635652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 26133183 - 26133240
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
26133240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 27916772 - 27916707
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27916772 |
aaaataaaggttaaaatatggttttattccctgcaaatatgcctcgttttggttttagtctctgta |
27916707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 33336026 - 33335969
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgta |
33335969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 40764413 - 40764470
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40764413 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 293825 - 293885
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
293825 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccatgta |
293885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 1105149 - 1105093
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1105149 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 1381244 - 1381304
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1381244 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
1381304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 153 - 205
Target Start/End: Original strand, 4203454 - 4203506
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4203454 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 9179923 - 9179863
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
9179923 |
aaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgta |
9179863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 18046035 - 18046095
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
18046035 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
18046095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 19565832 - 19565776
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19565832 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 21124910 - 21124970
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21124910 |
aaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgta |
21124970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 6118499 - 6118444
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
6118444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 6912497 - 6912552
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 13990897 - 13990838
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13990897 |
aaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
13990838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 18633961 - 18633906
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctg |
18633906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 19565459 - 19565522
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19565459 |
aaaatcaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 20660946 - 20661005
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20660946 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccttgta |
20661005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 25561705 - 25561760
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
25561760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 34125634 - 34125575
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
34125634 |
aaggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgta |
34125575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 35876680 - 35876743
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35876680 |
aaaatcaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 1104857 - 1104915
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1104857 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgta |
1104915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 4203771 - 4203713
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4203771 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
4203713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 10744055 - 10743997
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
10744055 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgta |
10743997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 144 - 210
Target Start/End: Original strand, 29875390 - 29875455
Alignment:
| Q |
144 |
ataaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29875390 |
ataaaaataa-ggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg |
29875455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 34125306 - 34125364
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34125306 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
34125364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 37271358 - 37271416
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37271358 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgta |
37271416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 45138 - 45195
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
45195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 146 - 207
Target Start/End: Complemental strand, 2637002 - 2636941
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2637002 |
aaaaaaaaaagctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 5614158 - 5614223
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
5614158 |
aaaaaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgta |
5614223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 9532539 - 9532478
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
9532539 |
taaaggttaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgta |
9532478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 11799127 - 11799184
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
11799127 |
aaggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 20986091 - 20986034
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20986091 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 21050913 - 21050856
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgta |
21050856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 24443378 - 24443435
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24443378 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 24781988 - 24782045
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24781988 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24782045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 25562000 - 25561951
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25562000 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 29151853 - 29151796
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
29151853 |
aaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg |
29151796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 29366949 - 29366892
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
29366892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 30888160 - 30888217
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
30888217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 35928458 - 35928401
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35928401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 38496784 - 38496727
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38496784 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
38496727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 39379611 - 39379558
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39379611 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
39379558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 3850600 - 3850544
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3850600 |
aggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 5917125 - 5917181
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5917125 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 6912860 - 6912800
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6912860 |
aaagactaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
6912800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 10409327 - 10409275
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10409327 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 18258530 - 18258470
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
18258530 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgta |
18258470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 19685016 - 19685072
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19685016 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 23382297 - 23382245
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 150 - 210
Target Start/End: Complemental strand, 37271711 - 37271651
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
37271711 |
ataaaggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 39379242 - 39379294
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 4736544 - 4736485
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4736544 |
aaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgta |
4736485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 16038738 - 16038683
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgta |
16038683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 20683745 - 20683804
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
20683745 |
aaggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgta |
20683804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 28213371 - 28213430
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
28213371 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccatgta |
28213430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 28871996 - 28871937
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28871996 |
aaggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgta |
28871937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 29151516 - 29151571
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
29151571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 29693092 - 29693033
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
29693092 |
aaggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttgta |
29693033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 204
Target Start/End: Original strand, 35166909 - 35166960
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35166909 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 149 - 212
Target Start/End: Original strand, 35609297 - 35609360
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35609297 |
aataatggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgta |
35609360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 40029139 - 40029198
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||| |
|
|
| T |
40029139 |
aaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgta |
40029198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 3850299 - 3850357
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-ttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctgta |
3850357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 9179592 - 9179650
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgta |
9179650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 12144906 - 12144964
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
12144906 |
aggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgta |
12144964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 14318044 - 14318102
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
14318044 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccttgta |
14318102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 20690732 - 20690790
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
20690732 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgta |
20690790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 23381949 - 23382007
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
23381949 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgta |
23382007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 25779163 - 25779105
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||| |
|
|
| T |
25779163 |
aggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgta |
25779105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 28108159 - 28108105
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgta |
28108105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 31037742 - 31037684
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||| |
|
|
| T |
31037742 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctctgta |
31037684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 35877053 - 35876995
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
35877053 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgta |
35876995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 40168009 - 40167951
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
40168009 |
aggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgta |
40167951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 42207241 - 42207299
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
42207241 |
aggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgta |
42207299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 1286682 - 1286739
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgta |
1286739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 2032940 - 2032883
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtccatgta |
2032883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 18258160 - 18258217
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
18258160 |
aaggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 20661311 - 20661254
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgta |
20661254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 153 - 205
Target Start/End: Complemental strand, 18286743 - 18286691
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18286743 |
aaggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 35166159 - 35166103
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
35166159 |
aggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg |
35166103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 145 - 212
Target Start/End: Complemental strand, 3851339 - 3851272
Alignment:
| Q |
145 |
taaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
3851339 |
taaaaatgtaggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgta |
3851272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 150 - 209
Target Start/End: Complemental strand, 27850379 - 27850320
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||| |||||||||| |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27850379 |
ataaagactaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 5904007 - 5904065
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
5904007 |
aggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgta |
5904065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 17070864 - 17070806
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||| ||||||| ||||||| |
|
|
| T |
17070864 |
aggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctgta |
17070806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 42207570 - 42207517
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctgt |
42207517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 42596814 - 42596760
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgta |
42596760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 15635374 - 15635431
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
15635374 |
aaggataaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg |
15635431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 147 - 208
Target Start/End: Original strand, 20416352 - 20416413
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||| |||| |||||||| |||||| |
|
|
| T |
20416352 |
aaaattaaggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc |
20416413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 21050575 - 21050632
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgta |
21050632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 26071620 - 26071559
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| ||||||||| |||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26071620 |
taaaggttaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgta |
26071559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 32888691 - 32888744
Alignment:
| Q |
159 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgta |
32888744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 36973710 - 36973653
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgta |
36973653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 143 - 212
Target Start/End: Original strand, 40038482 - 40038551
Alignment:
| Q |
143 |
aataaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||| | |||||||||||||||||| |||||||||||||||||||||||| ||||| ||| |||| |
|
|
| T |
40038482 |
aataaaaaaataggctaaaatatggttttgatccctgcaaatatgcctcgttttgattttaatccgtgta |
40038551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 40038858 - 40038801
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgta |
40038801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 42553642 - 42553699
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgta |
42553699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 17070532 - 17070591
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
17070532 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctgta |
17070591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 203
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 206
Target Start/End: Original strand, 2636669 - 2636720
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 31037397 - 31037452
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||| |||||||| ||||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgattttagtctctgta |
31037452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 38555084 - 38555030
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38555084 |
aggctaaaatatggtttg-gtccctgcaaatatgcctcattttggttttagtccct |
38555030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 10830528 - 10830586
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||| || ||||||||||| |||||||||||||| |||||| |
|
|
| T |
10830528 |
aggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgta |
10830586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 15916286 - 15916340
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 26071290 - 26071348
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgta |
26071348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 28871640 - 28871694
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| |||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
28871640 |
taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgta |
28871694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 32108807 - 32108865
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
32108807 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgta |
32108865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 210
Target Start/End: Original strand, 6118139 - 6118188
Alignment:
| Q |
162 |
atatggttttagtccctgcaaatatgcctcgtttt-ggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
6118139 |
atatggttttagtctctgcaaatatgcctcgttttgggttttagtccctg |
6118188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 27916462 - 27916518
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| | ||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctgta |
27916518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 29855614 - 29855670
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| |||| |||| || ||||||||||| |||||||||||||||||||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgta |
29855670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 38452399 - 38452339
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| ||||||||| ||||| || ||||| |
|
|
| T |
38452399 |
aaagcctaaaatatggttttggtccctgcaaatatgtctcgttttgattttaatctctgta |
38452339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 1287047 - 1286988
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||||| ||| ||||||||||||| |||||| |
|
|
| T |
1287047 |
aaggttaaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgta |
1286988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 38554750 - 38554806
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
38554750 |
aggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagtctctgta |
38554806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 205
Target Start/End: Complemental strand, 5104001 - 5103951
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||| ||||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 18286431 - 18286485
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||| || |||||||||||| ||| |||| |
|
|
| T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggttttaatccttgta |
18286485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 20418013 - 20417963
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||||||||| |||||||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc |
20417963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 22551328 - 22551262
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| ||| |||||||||||||||||||| ||| ||||||| | ||||||||||||||| ||||| |
|
|
| T |
22551328 |
aaaaaaaaaagctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtctctgta |
22551262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 36973353 - 36973403
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||| ||| || |||||||| ||||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 9588611 - 9588554
Alignment:
| Q |
156 |
gctaaaatatggttttag-tccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| |||| | |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtccatgta |
9588554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 206
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||| |||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 24782274 - 24782218
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||||||||| |||||||||||||| |
|
|
| T |
24782274 |
ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccctgta |
24782218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 152 - 201
Target Start/End: Complemental strand, 38182090 - 38182041
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
201 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
38182090 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 152 - 201
Target Start/End: Original strand, 38189041 - 38189090
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
201 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
38189041 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 152 - 201
Target Start/End: Complemental strand, 38209316 - 38209267
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
201 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
38209316 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 152 - 201
Target Start/End: Original strand, 38216266 - 38216315
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
201 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
38216266 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 211
Target Start/End: Complemental strand, 1286974 - 1286931
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
1286974 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgt |
1286931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 179
Target Start/End: Original strand, 13990628 - 13990659
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13990628 |
aaataaaggctaaaatatggttttagtccctg |
13990659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 31602137 - 31602188
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtt |
200 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||||||||| ||||||||||| |
|
|
| T |
31602137 |
aatataggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt |
31602188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 42596451 - 42596510
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| || |||||||||||||| |||||| |
|
|
| T |
42596451 |
aaggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctgta |
42596510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 1105075 - 1105033
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
1105075 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1105033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 179
Target Start/End: Original strand, 9532216 - 9532246
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9532216 |
aataaaggctaaaatatggttttagtccctg |
9532246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 10830898 - 10830844
Alignment:
| Q |
154 |
aggctaaaatatggttttag-tccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||||| ||||||||||||||| |
|
|
| T |
10830898 |
aggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagtcc |
10830844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 202
Target Start/End: Original strand, 28213446 - 28213480
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
28213446 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28213480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 28871711 - 28871753
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
28871711 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
28871753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 206
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
31602259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 36278080 - 36278138
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||| |||||||||| |||| |
|
|
| T |
36278080 |
aggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagtccatgta |
36278138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 179
Target Start/End: Original strand, 37090408 - 37090442
Alignment:
| Q |
145 |
taaaaataaaggctaaaatatggttttagtccctg |
179 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
37090408 |
taaaaaaaaaggctaaaatatggttttagtccctg |
37090442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 186
Target Start/End: Complemental strand, 3938125 - 3938088
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
3938125 |
aatataggctaaaatatgcttttagtccctgcaaatat |
3938088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 199
Target Start/End: Original strand, 4736204 - 4736249
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
199 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
4736204 |
aggctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 198
Target Start/End: Original strand, 7085477 - 7085520
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgg |
198 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| ||||||| |
|
|
| T |
7085477 |
aggctaaaatatggtttt-gtccctgtaaatatgccttgttttgg |
7085520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 30888434 - 30888374
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| ||||||| | | |||||| |||||||||||||||||| ||||| |
|
|
| T |
30888434 |
aaaggctaaaatatgattttagtatccgtaaatatatctcgttttggttttagtctctgta |
30888374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 208
Target Start/End: Original strand, 32888760 - 32888800
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
32888760 |
ttttggtccctgcaaatatgccttgttttggttttggtccc |
32888800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 183
Target Start/End: Original strand, 35165937 - 35165965
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35165937 |
ggctaaaatatggttttagtccctgcaaa |
35165965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 63; Significance: 1e-27; HSPs: 194)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 150 - 212
Target Start/End: Original strand, 43477158 - 43477220
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43477158 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
43477220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 27341594 - 27341534
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27341594 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
27341534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 10872906 - 10872972
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10872906 |
aaaaataaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgta |
10872972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 153 - 211
Target Start/End: Complemental strand, 14239082 - 14239024
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14239082 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14239024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 32418309 - 32418375
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32418309 |
aaaaaaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
32418375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 11976369 - 11976430
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11976369 |
taaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
11976430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 16789369 - 16789312
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
16789312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 22917562 - 22917619
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22917562 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22917619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 19494414 - 19494358
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 29488113 - 29488053
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29488113 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgta |
29488053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 152 - 211
Target Start/End: Original strand, 14238748 - 14238807
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14238748 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14238807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 14495067 - 14495126
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14495067 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
14495126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 28346386 - 28346449
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28346386 |
aaaattaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 145 - 212
Target Start/End: Original strand, 40066487 - 40066554
Alignment:
| Q |
145 |
taaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
40066487 |
taaatataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgta |
40066554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 206
Target Start/End: Original strand, 1525806 - 1525860
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1525806 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 4017303 - 4017245
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4017303 |
aaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 150 - 212
Target Start/End: Original strand, 22650459 - 22650521
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22650459 |
ataaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
22650521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 29158353 - 29158411
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29158353 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
29158411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 37536083 - 37536141
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37536083 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 4375692 - 4375749
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgta |
4375749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 7272751 - 7272694
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgta |
7272694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 7326421 - 7326364
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
7326364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 8298979 - 8298918
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8298979 |
taaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
8298918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 10776499 - 10776442
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
10776442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 16644046 - 16643989
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16644046 |
aaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
16643989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 20984142 - 20984203
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20984142 |
taaaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgta |
20984203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 154 - 211
Target Start/End: Complemental strand, 33526413 - 33526356
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33526413 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33526356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 34963298 - 34963355
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34963298 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 40066820 - 40066763
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgta |
40066763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 40844156 - 40844213
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
40844213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 1526173 - 1526117
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1526173 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
1526117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 4710221 - 4710165
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4710221 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 6146948 - 6146892
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgta |
6146892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 11019858 - 11019802
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019858 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 140 - 212
Target Start/End: Original strand, 14488701 - 14488773
Alignment:
| Q |
140 |
atgaataaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| ||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
14488701 |
atgaagaaaaacaaaggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgta |
14488773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 16643660 - 16643716
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16643660 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
16643716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 20277689 - 20277749
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20277689 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgta |
20277749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 21064316 - 21064376
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21064316 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgta |
21064376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 28346759 - 28346703
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28346759 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 32726272 - 32726216
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726272 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 152 - 207
Target Start/End: Original strand, 1685111 - 1685166
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1685111 |
aaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1685166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 2728597 - 2728542
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 4474046 - 4473987
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4474046 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgta |
4473987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 7272418 - 7272477
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
7272418 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgta |
7272477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 7420592 - 7420533
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7420592 |
aaggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgta |
7420533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 10540784 - 10540725
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10540784 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgta |
10540725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 11019512 - 11019575
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11019512 |
aaaattaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 16789073 - 16789132
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
16789073 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
16789132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 20984516 - 20984453
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
20984516 |
aataaaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgta |
20984453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 21125717 - 21125776
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21125717 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
21125776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 24187567 - 24187626
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24187567 |
aaggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgta |
24187626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 24187905 - 24187842
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24187905 |
aaaaaaaaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 24955011 - 24954956
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24955011 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct |
24954956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 25131109 - 25131168
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
25131109 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
25131168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 151 - 210
Target Start/End: Original strand, 32725903 - 32725962
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32725903 |
taaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 35097692 - 35097637
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 4016906 - 4016960
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
4016960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 7420227 - 7420285
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7420227 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 8094842 - 8094788
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8094842 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 10337118 - 10337176
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10337118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
10337176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 18549200 - 18549258
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18549200 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgta |
18549258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 25131447 - 25131393
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 147 - 209
Target Start/End: Complemental strand, 27117984 - 27117922
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
27117984 |
aaaataaaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 33636321 - 33636375
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33636321 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
33636375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 35345618 - 35345560
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35345618 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgta |
35345560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 40492959 - 40493017
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40492959 |
aggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgta |
40493017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 40844540 - 40844478
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40844540 |
ataaaggttaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgta |
40844478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 4621354 - 4621297
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
4621297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 7186004 - 7185947
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
7185947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 149 - 210
Target Start/End: Original strand, 8094473 - 8094534
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
8094473 |
aatataggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg |
8094534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 8298587 - 8298644
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
8298644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 9175004 - 9175069
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
9175004 |
aaaataaaggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgta |
9175069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 9496725 - 9496668
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9496725 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 14489073 - 14489016
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
14489016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 38930666 - 38930609
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38930666 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctg |
38930609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 42133154 - 42133097
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
42133097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 1408355 - 1408299
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
1408355 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct |
1408299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 146 - 210
Target Start/End: Original strand, 2728223 - 2728287
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| ||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2728223 |
aaaaacaaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 3511905 - 3511961
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3511905 |
aggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 3512267 - 3512211
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3512267 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 6146517 - 6146573
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgta |
6146573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 7326085 - 7326141
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7326085 |
aggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 10337450 - 10337394
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10337450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 153 - 209
Target Start/End: Original strand, 14496814 - 14496870
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
14496814 |
aaggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct |
14496870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 19494118 - 19494174
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19494118 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
19494174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 24090487 - 24090431
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgta |
24090431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 153 - 209
Target Start/End: Original strand, 28323847 - 28323903
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28323847 |
aaggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 35097327 - 35097383
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35097327 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 35346999 - 35346943
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35346999 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 1162909 - 1162964
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
1162964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 1778564 - 1778619
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 5357422 - 5357477
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5357422 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 150 - 209
Target Start/End: Complemental strand, 10755533 - 10755474
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
10755533 |
ataagggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 10873280 - 10873225
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 18549571 - 18549516
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgta |
18549516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 34963664 - 34963609
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 35346629 - 35346684
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 37536419 - 37536364
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 6469279 - 6469337
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6469279 |
aggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgta |
6469337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 13232201 - 13232255
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13232255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 147 - 205
Target Start/End: Complemental strand, 13232570 - 13232512
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
13232570 |
aaaataatggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 17073806 - 17073864
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
17073806 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
17073864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 17574464 - 17574406
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
17574464 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
17574406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 20278058 - 20278000
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
20278058 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgta |
20278000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 21064685 - 21064627
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
21064685 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgta |
21064627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 25600229 - 25600287
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
25600229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgta |
25600287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 28399036 - 28398978
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28399036 |
aggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgta |
28398978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 28497616 - 28497562
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
28497562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 44997922 - 44997988
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||| | |||||| |
|
|
| T |
44997922 |
aaaaataaaggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctgta |
44997988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 15719656 - 15719709
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc |
15719709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 38930300 - 38930357
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
38930300 |
aaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg |
38930357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 4473703 - 4473759
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
4473703 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 9496340 - 9496396
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
9496340 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 13779531 - 13779475
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctgta |
13779475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 25600600 - 25600540
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
25600600 |
aaaggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgta |
25600540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 28497252 - 28497312
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
28497252 |
aaaggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtccatgta |
28497312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 155 - 207
Target Start/End: Original strand, 33526052 - 33526104
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 35115640 - 35115584
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
35115640 |
aggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 35143845 - 35143789
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
35143845 |
aggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 10540448 - 10540503
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10540448 |
aggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 10776150 - 10776205
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgta |
10776205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 28324183 - 28324124
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
28324183 |
aaggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgta |
28324124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 42132864 - 42132919
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 9175368 - 9175314
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtctctgta |
9175314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 13154885 - 13154943
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13154885 |
aggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgta |
13154943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 13155252 - 13155194
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
13155252 |
aggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgta |
13155194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 19962994 - 19963052
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
19962994 |
aggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgta |
19963052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 21126022 - 21125964
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||||||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
21126022 |
aggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgta |
21125964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 24815069 - 24815011
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgta |
24815011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 25702511 - 25702569
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
25702511 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgta |
25702569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 27117752 - 27117810
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27117752 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgta |
27117810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 29992301 - 29992243
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29992301 |
aggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgta |
29992243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 32040074 - 32040132
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32040074 |
aggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgta |
32040132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 3680803 - 3680746
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3680803 |
aaggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 29158669 - 29158612
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtccttgta |
29158612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 36044800 - 36044735
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| || ||||||||||||||| || ||||| |
|
|
| T |
36044800 |
aaaataaaagctaaaatatggttttggtccctgcaaatgtgtctcgttttggttttaatctctgta |
36044735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 200
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 42430120 - 42430063
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgta |
42430063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 3680532 - 3680584
Alignment:
| Q |
160 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgta |
3680584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 4376011 - 4375960
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
4376011 |
aggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc |
4375960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 29991912 - 29991972
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
29991912 |
aaaggttaaaatatggttttggtctctgcaaatatgcctcgttttagttttagtctctgta |
29991972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 153 - 201
Target Start/End: Complemental strand, 30337219 - 30337171
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
201 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30337219 |
aaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 206
Target Start/End: Complemental strand, 1163274 - 1163223
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||| ||||||||| |
|
|
| T |
1163274 |
ggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtc |
1163223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 13779151 - 13779206
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgta |
13779206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
| Q |
160 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 26530666 - 26530725
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||| |||| |||||||| |||||| |
|
|
| T |
26530666 |
aaggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctgta |
26530725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 33652193 - 33652240
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagt |
33652240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 42429756 - 42429814
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
42429756 |
aaggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctgta |
42429814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 43727097 - 43727152
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||| ||||||| |||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgta |
43727152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 43727431 - 43727377
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccttgta |
43727377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 206
Target Start/End: Complemental strand, 5357762 - 5357712
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc |
5357712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 1408005 - 1408054
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
204 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||| ||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 2811783 - 2811730
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
2811783 |
aaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 152 - 209
Target Start/End: Original strand, 14847822 - 14847879
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14847822 |
aaaggttaaaatatgattttgatccctgcaaatatgcctcattttggttttagtccct |
14847879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 28258242 - 28258189
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||||||||||||| |
|
|
| T |
28258242 |
aggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 15930933 - 15930989
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| |||| || ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgta |
15930989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 191
Target Start/End: Original strand, 28398756 - 28398792
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28398756 |
ggctaaaatatggttttagtccctgcaaatatgcctc |
28398792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 207
Target Start/End: Original strand, 29487750 - 29487802
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 30969399 - 30969455
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgta |
30969455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 206
Target Start/End: Complemental strand, 31445471 - 31445412
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
31445471 |
aaaaaaaaggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc |
31445412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 6469668 - 6469610
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
6469668 |
aggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgta |
6469610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 7420303 - 7420345
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
7420303 |
ttttagtccctgcaaatatgcctcattttggttttggtccctg |
7420345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 13232271 - 13232313
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
13232271 |
ttttagtccctgcaaatatgcctcattttggttttggtccctg |
13232313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 13796593 - 13796539
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctgta |
13796539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 20277765 - 20277807
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
20277765 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctg |
20277807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 21064392 - 21064434
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
21064392 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctg |
21064434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 23939547 - 23939597
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||| |||||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 23939915 - 23939853
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
23939915 |
ataaaggttaaaatatggttttgattcctgcaaatatgactcgttttggctttagtccatgta |
23939853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 27341257 - 27341315
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||| ||||||||| |||| |
|
|
| T |
27341257 |
aggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagtccttgta |
27341315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 42430047 - 42430005
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42430047 |
tttttgtccctgcaaatatgcctcgttttggttttggtccctg |
42430005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 212
Target Start/End: Complemental strand, 1778917 - 1778872
Alignment:
| Q |
167 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctgta |
1778872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 209
Target Start/End: Original strand, 2355885 - 2355941
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||| | ||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
2355885 |
aaggctaaaatataggtttgatccctgcaaatataccttgttttggttttagtccct |
2355941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 9832212 - 9832272
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||||||| | |||||||||||| |||||||| |
|
|
| T |
9832212 |
aaaggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgta |
9832272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 21509919 - 21509883
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcct |
190 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21509919 |
aggctaaaatatgattttagtccctgcaaatatgcct |
21509883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 30969717 - 30969681
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctc |
191 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 44998263 - 44998211
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||||||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtcc |
44998211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 156 - 207
Target Start/End: Complemental strand, 7578527 - 7578476
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||| ||||||| | |||||||||||| ||| ||||||||||||||| |
|
|
| T |
7578527 |
gctaaaatacggttttaattcctgcaaatatgactcattttggttttagtcc |
7578476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 4473777 - 4473819
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
4473777 |
ttttagtccctgcaaatatgccttattttggttttggtccctg |
4473819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 8298660 - 8298702
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
8298660 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
8298702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
197 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| ||||||||| |
|
|
| T |
9908918 |
ggctaaaatatagttttaatccctgcaaatatgtctcgttttg |
9908960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 10540522 - 10540564
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
10540522 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
10540564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 14848186 - 14848137
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||||||| ||||| ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
14848186 |
taaaatatgattttaatcc-tgcaaatatgtctcgttttggttttagtccc |
14848137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 17074095 - 17074053
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
17074095 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17074053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 17574175 - 17574217
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
17574175 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17574217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 23939620 - 23939662
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23939620 |
ttttggtccctgcaaatatatctcgttttggttttagtccctg |
23939662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 25702810 - 25702768
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
196 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||| |
|
|
| T |
25702810 |
aggctaaaatatggttttggtccctgcaaatatgtctcatttt |
25702768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 179
Target Start/End: Complemental strand, 32040350 - 32040316
Alignment:
| Q |
145 |
taaaaataaaggctaaaatatggttttagtccctg |
179 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
32040350 |
taaaaaaaaaggctaaaatatggttttagtccctg |
32040316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 44998191 - 44998149
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
44998191 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
44998149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 210
Target Start/End: Original strand, 4709929 - 4709961
Alignment:
| Q |
178 |
tgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
4709929 |
tgcaaatatgtctcgttttggttttagtccctg |
4709961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 15719982 - 15719922
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| || |||||||||||| ||| |||| |
|
|
| T |
15719982 |
aaaggctaaaatataattttagtttctgcaaatatgtcttgttttggttttaatccttgta |
15719922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 206
Target Start/End: Original strand, 17574105 - 17574153
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||| |||||||| |
|
|
| T |
17574105 |
taaaatatggttttggtccctgcaaatatgtcgggttttgattttagtc |
17574153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 209
Target Start/End: Original strand, 24090117 - 24090173
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||| || | || | ||||| ||||||||| ||||||||||| |
|
|
| T |
24090117 |
aaggctaaaatatggttttggttcttgtagatatgtctcgttttgattttagtccct |
24090173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 6e-27; HSPs: 203)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 8555807 - 8555742
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8555807 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
8555742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 19757744 - 19757805
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19757744 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
19757805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 12894405 - 12894345
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12894405 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
12894345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 146 - 210
Target Start/End: Complemental strand, 25988758 - 25988694
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988758 |
aaaaataaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 1614910 - 1614847
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1614910 |
aataaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
1614847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 28911908 - 28911849
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28911908 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
28911849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 6108331 - 6108389
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6108331 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
6108389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 17999722 - 17999664
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17999722 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
17999664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 44509057 - 44508999
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44509057 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 3975545 - 3975606
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3975545 |
taaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
3975606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 9659693 - 9659632
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9659693 |
taaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
9659632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 6509205 - 6509265
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6509205 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgta |
6509265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 37372907 - 37372847
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37372907 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgta |
37372847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 44344792 - 44344732
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44344792 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
44344732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 1006835 - 1006890
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1006890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 145 - 212
Target Start/End: Original strand, 6079799 - 6079866
Alignment:
| Q |
145 |
taaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6079799 |
taaaaaaaaaagctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
6079866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 6509472 - 6509413
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6509472 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
6509413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 23676460 - 23676397
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23676460 |
aaaatataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 44508720 - 44508775
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 45073643 - 45073584
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45073643 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
45073584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 45228920 - 45228861
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45228920 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
45228861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 20388273 - 20388331
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20388273 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgta |
20388331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 28911576 - 28911634
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28911576 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgta |
28911634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 39832905 - 39832963
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39832905 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
39832963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 1559709 - 1559648
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1559709 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgta |
1559648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 149 - 210
Target Start/End: Original strand, 5233802 - 5233863
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5233802 |
aataaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 10358368 - 10358311
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
10358311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 16853589 - 16853532
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
16853532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 17999465 - 17999522
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgta |
17999522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 19561450 - 19561393
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
19561393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 27458391 - 27458456
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27458391 |
aaaaaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
27458456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 35210515 - 35210458
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
35210458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 39833236 - 39833179
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgta |
39833179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 8144659 - 8144603
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8144659 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 21223750 - 21223694
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21223750 |
aaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 23399611 - 23399667
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23399611 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 26878072 - 26878016
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26878072 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 29198663 - 29198607
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29198663 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 35015221 - 35015165
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35015221 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35015165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 48192489 - 48192433
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48192489 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 206
Target Start/End: Original strand, 7431951 - 7432002
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 13770083 - 13770024
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
13770083 |
aaggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgta |
13770024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 23399984 - 23399921
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23399984 |
aaaaaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 151 - 210
Target Start/End: Original strand, 25092156 - 25092215
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25092156 |
taaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 32189388 - 32189333
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgta |
32189333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 44402958 - 44403017
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
44402958 |
aaggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgta |
44403017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 5354767 - 5354825
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5354767 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgta |
5354825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 8144292 - 8144350
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8144292 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 10358000 - 10358058
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358000 |
aggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgta |
10358058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 14739007 - 14738949
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
14739007 |
aaaggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
14738949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 18022705 - 18022647
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18022705 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgta |
18022647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 21554754 - 21554696
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
21554754 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgta |
21554696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 23816669 - 23816727
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
23816669 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgta |
23816727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 25092551 - 25092493
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25092551 |
aaaggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 30352557 - 30352615
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30352557 |
aaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 35104296 - 35104238
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35104296 |
aggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
35104238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 35665876 - 35665934
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35665876 |
aggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgta |
35665934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 35838338 - 35838280
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35838338 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35838280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 39719643 - 39719585
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
39719643 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgta |
39719585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 41054237 - 41054179
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41054237 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
41054179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 45073313 - 45073371
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
45073313 |
aggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgta |
45073371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 46828935 - 46829001
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
46828935 |
aaaaattaaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgta |
46829001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 48192254 - 48192312
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48192254 |
aaaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 1974009 - 1974066
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
1974066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 3975839 - 3975786
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3975839 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 5234208 - 5234147
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
5234208 |
taaaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgta |
5234147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 13769774 - 13769831
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
13769831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 25547490 - 25547433
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
25547433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 31732101 - 31732158
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgta |
31732158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 37372441 - 37372494
Alignment:
| Q |
159 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
37372494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 46648719 - 46648658
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
46648719 |
taaaggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttaatccttgta |
46648658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 1614558 - 1614614
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1614558 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 2945848 - 2945788
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2945848 |
aaaggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgta |
2945788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 16940759 - 16940819
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16940759 |
aaaggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgta |
16940819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 25988384 - 25988440
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25988384 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 150 - 210
Target Start/End: Original strand, 30223456 - 30223516
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
30223456 |
ataaaggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 144 - 212
Target Start/End: Original strand, 35837914 - 35837981
Alignment:
| Q |
144 |
ataaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
35837914 |
ataaaaataa-ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgta |
35837981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 144 - 212
Target Start/End: Original strand, 41053832 - 41053899
Alignment:
| Q |
144 |
ataaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
41053832 |
ataaaaataa-ggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgta |
41053899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 45021494 - 45021550
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttt-ggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 48852441 - 48852501
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
48852441 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccttgta |
48852501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 5308688 - 5308630
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5308688 |
aaggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctgta |
5308630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 17854151 - 17854206
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgta |
17854206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 27037593 - 27037648
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 30223797 - 30223738
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
30223797 |
aaggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgta |
30223738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 30352904 - 30352849
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30352849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 149 - 204
Target Start/End: Complemental strand, 31732457 - 31732402
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
31732457 |
aataaaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 35104070 - 35104133
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35104070 |
aaaataaaggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 151 - 210
Target Start/End: Complemental strand, 39439033 - 39438974
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
39439033 |
taaaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 151 - 210
Target Start/End: Complemental strand, 44568694 - 44568635
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44568694 |
taaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 45021857 - 45021806
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45021857 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 211
Target Start/End: Original strand, 1559341 - 1559399
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
1559341 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgt |
1559399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 6589283 - 6589217
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
6589283 |
aaaaaaaaaggttaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccatgta |
6589217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 11767276 - 11767218
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
11767276 |
aggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgta |
11767218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 12932784 - 12932726
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12932784 |
aggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgta |
12932726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 16941049 - 16940995
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
16940995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 19783814 - 19783872
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
19783814 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
19783872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 28262712 - 28262770
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
28262712 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgta |
28262770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 150 - 212
Target Start/End: Original strand, 39520393 - 39520455
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||| |||| | |||||||| |||||||||||||||||||||||| |
|
|
| T |
39520393 |
ataaaggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgta |
39520455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 44403249 - 44403195
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct |
44403195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 46304084 - 46304138
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46304084 |
aaggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 46759657 - 46759715
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
46759657 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgta |
46759715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 155 - 205
Target Start/End: Complemental strand, 48359075 - 48359025
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 5308323 - 5308380
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgta |
5308380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 21223405 - 21223462
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgta |
21223462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 21554393 - 21554450
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtccttgta |
21554450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 39719353 - 39719410
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgta |
39719410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 44568324 - 44568381
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44568324 |
aaggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 46304384 - 46304327
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
46304327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 46759942 - 46759885
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgta |
46759885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 1007229 - 1007177
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtcc |
1007177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 164 - 212
Target Start/End: Complemental strand, 1271590 - 1271542
Alignment:
| Q |
164 |
atggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
1271542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 155 - 207
Target Start/End: Original strand, 6589021 - 6589073
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 14543707 - 14543767
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
14543707 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccatgta |
14543767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 19465987 - 19465924
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
19465987 |
aaatataggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctgta |
19465924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 146 - 205
Target Start/End: Original strand, 25547243 - 25547303
Alignment:
| Q |
146 |
aaaaataa-aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25547243 |
aaaaataataggttaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 29198302 - 29198358
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29198302 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 30709645 - 30709593
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30709645 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 153 - 201
Target Start/End: Complemental strand, 31310681 - 31310633
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31310681 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 39438740 - 39438792
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
39438740 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 44958509 - 44958449
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| |||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
44958509 |
aaaggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgta |
44958449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 489074 - 489015
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
489074 |
aaggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgta |
489015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 6847117 - 6847062
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtctctgta |
6847062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 30709323 - 30709382
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
30709323 |
aaggttaaaatatgattttagtccctacaaatatgcctcgttttggttttagtccttgta |
30709382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 38186364 - 38186423
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
38186364 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctgta |
38186423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 156 - 207
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 23817039 - 23816977
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||| ||||||||||| ||||| |||||| |
|
|
| T |
23817039 |
ataaaggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgta |
23816977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 31310364 - 31310422
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
31310364 |
aggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgta |
31310422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 31503780 - 31503726
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtctctgta |
31503726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 35470281 - 35470223
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35470281 |
aggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgta |
35470223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 44841359 - 44841413
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgta |
44841413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 156 - 205
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 20388675 - 20388618
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
20388675 |
ggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgta |
20388618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 26877676 - 26877733
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||||||||||||||||||||| |
|
|
| T |
26877676 |
aaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 34878129 - 34878068
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| || ||||| |
|
|
| T |
34878129 |
taaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttaatctctgta |
34878068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 156 - 205
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 46829312 - 46829255
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgta |
46829255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 5355114 - 5355066
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 9659354 - 9659410
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
9659354 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 18311581 - 18311637
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| || ||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggttttattctctgta |
18311637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 203
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 37527421 - 37527365
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgta |
37527365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 211
Target Start/End: Original strand, 41364884 - 41364940
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgt |
41364940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 45228614 - 45228670
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
45228614 |
aggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 48854073 - 48854013
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48854073 |
aaaggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgta |
48854013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 145 - 212
Target Start/End: Original strand, 31503410 - 31503477
Alignment:
| Q |
145 |
taaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| ||||| |||||||||||||| | ||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
31503410 |
taaaaaaaaaggttaaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgta |
31503477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 37952671 - 37952726
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctgta |
37952726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 39520732 - 39520673
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
39520732 |
aaggttaaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgta |
39520673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 43058752 - 43058807
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctgta |
43058807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 3807863 - 3807921
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
3807863 |
aggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgta |
3807921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 6892261 - 6892203
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||| || ||||||| ||||||||||||| |
|
|
| T |
6892261 |
aggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgta |
6892203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 12894056 - 12894098
Alignment:
| Q |
170 |
ttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12894056 |
ttagtccctgcaaatatgcctcgttttggttttaatccctgta |
12894098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 19758044 - 19758002
Alignment:
| Q |
170 |
ttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19758044 |
ttagtccctgcaaatatgcctcattttggttttagtccctgta |
19758002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 24717532 - 24717478
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 45671217 - 45671271
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |||||||| |||||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgta |
45671271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 6954862 - 6954915
Alignment:
| Q |
159 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtctctgta |
6954915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 14738603 - 14738652
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggttttagtcc |
14738652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 22539929 - 22539986
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| ||||||||||||| ||||| |
|
|
| T |
22539929 |
aggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctgt |
22539986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 163 - 212
Target Start/End: Original strand, 24953828 - 24953877
Alignment:
| Q |
163 |
tatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggttttagtccatgta |
24953877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 28528905 - 28528962
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| || |||| ||||||| ||||||| |||||||||||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgta |
28528962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 35210181 - 35210238
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
35210181 |
aggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgt |
35210238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 35469880 - 35469937
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgta |
35469937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 37953053 - 37953000
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
37953053 |
aaggataaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 44344453 - 44344514
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||| ||||||| ||||||| ||| |||| |
|
|
| T |
44344453 |
taaaggctaaaatatggttttagttcccgcaaatatgtctcgtttcggttttaatccttgta |
44344514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 7432249 - 7432201
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||| |||||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtc |
7432201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 38486791 - 38486739
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| |||||||||||||||| |
|
|
| T |
38486791 |
aggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 212
Target Start/End: Complemental strand, 41054163 - 41054119
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctgta |
41054119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 18926889 - 18926944
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| | | |||||||| ||||||||||||| |||||||||| |
|
|
| T |
18926889 |
ctaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctgta |
18926944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 206
Target Start/End: Complemental strand, 18927091 - 18927040
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
18927091 |
ggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc |
18927040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 209
Target Start/End: Complemental strand, 45671545 - 45671494
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct |
45671494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 38186763 - 38186709
Alignment:
| Q |
153 |
aaggctaaaatatggttttag-tccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
38186763 |
aaggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 201
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
161 |
aatatggttttagtccctgcaaatatgcctcgttttggttt |
201 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 205
Target Start/End: Complemental strand, 24954152 - 24954100
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
24954152 |
aaggttaaaatatggtcttagaccctgcaaatatgattcgttttggttttagt |
24954100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 212
Target Start/End: Complemental strand, 27458698 - 27458662
Alignment:
| Q |
176 |
cctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27458698 |
cctgcaaatatgcctcgttttagttttagtccctgta |
27458662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 28263074 - 28263014
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| | |||||| |||||||||||||| |
|
|
| T |
28263074 |
aaagactaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgta |
28263014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 202
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 18311938 - 18311883
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||| ||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
18311938 |
ctaaaatatgattttaatccctctaaatatgcctcgttttgattttagtccttgta |
18311883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 38486477 - 38486528
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| |||||||| |||||||| |
|
|
| T |
38486477 |
aggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagt |
38486528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 186
Target Start/End: Original strand, 38742169 - 38742212
Alignment:
| Q |
143 |
aataaaaataaaggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
|||||||| ||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
38742169 |
aataaaaaaaaaggttaaaatatgtttttagtccctgcaaatat |
38742212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 206
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
3808068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 3975766 - 3975724
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
3975766 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3975724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 9659428 - 9659470
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
9659428 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9659470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 19005598 - 19005648
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||| ||||| ||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
19005598 |
ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagt |
19005648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 20355407 - 20355461
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
20355407 |
aggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagtccc |
20355461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 27458472 - 27458514
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
27458472 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
27458514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 35470207 - 35470165
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
35470207 |
tttttgtccctgcaaatatgcctcattttggttttggtccctg |
35470165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 36687269 - 36687231
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatg |
187 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
36687269 |
aataaaggctaaaatatgattttggtccctgcaaatatg |
36687231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 41054103 - 41054061
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
41054103 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
41054061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 196
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
196 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactcgtttt |
44841673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 3954178 - 3954137
Alignment:
| Q |
171 |
tagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
3954178 |
tagtctctgcatatatgtctcgttttggttttagtccctgta |
3954137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 8555606 - 8555655
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| || |||||||||||| |
|
|
| T |
8555606 |
aggctaaaatatagttttagtttctgcaaatatgacttgttttggtttta |
8555655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 183
Target Start/End: Original strand, 35014927 - 35014956
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35014927 |
aggctaaaatatggttttagtccctgcaaa |
35014956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 35212066 - 35212123
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
35212066 |
aaggctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctg |
35212123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 6911079 - 6911139
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| |||| | ||||||| ||||||||| ||||||||| |||| |
|
|
| T |
6911079 |
aaaggctaaaatatgattttggtccttataaatatgtctcgttttgattttagtccttgta |
6911139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 208
Target Start/End: Complemental strand, 19005865 - 19005825
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
19005865 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
19005825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 186
Target Start/End: Complemental strand, 31848204 - 31848172
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
31848204 |
aggctaaaatatgtttttagtccctgcaaatat |
31848172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 203
Target Start/End: Original strand, 36684531 - 36684583
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
36684531 |
taaaggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta |
36684583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 179
Target Start/End: Original strand, 48358819 - 48358847
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48358819 |
taaaggctaaaatatggttttagtccctg |
48358847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 225)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 150 - 211
Target Start/End: Original strand, 1810922 - 1810983
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1810922 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
1810983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 45368487 - 45368547
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45368487 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
45368547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 29072495 - 29072554
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29072495 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29072554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 45290449 - 45290512
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45290449 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
45290512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 13770488 - 13770546
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13770488 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
13770546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 18302388 - 18302330
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
18302330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 22919683 - 22919741
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22919683 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
22919741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 52254174 - 52254240
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52254174 |
aaaaataaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgta |
52254240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 26061954 - 26062011
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26061954 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26062011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 32729051 - 32728994
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32729051 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
32728994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 152 - 209
Target Start/End: Original strand, 33379885 - 33379942
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33379885 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
33379942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 35308111 - 35308054
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
35308054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 990380 - 990324
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
990380 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
990324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 3679623 - 3679683
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3679623 |
aaaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
3679683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 3753214 - 3753270
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
3753270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 3753576 - 3753516
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3753576 |
taaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
3753516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 11822001 - 11822061
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11822001 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
11822061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 18473271 - 18473327
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18473271 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18473327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 18473597 - 18473541
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18473597 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 24507846 - 24507786
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24507846 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
24507786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 33045693 - 33045633
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33045693 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
33045633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 41358368 - 41358424
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 6567498 - 6567439
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6567498 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
6567439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 7001897 - 7001842
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7001842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 12361009 - 12361068
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12361009 |
aaggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgta |
12361068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 143 - 210
Target Start/End: Complemental strand, 19623028 - 19622962
Alignment:
| Q |
143 |
aataaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19623028 |
aataaaaataa-ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
19622962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 26442901 - 26442842
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26442901 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgta |
26442842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 31258331 - 31258394
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31258331 |
aaaattaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
31258394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 33000677 - 33000614
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33000677 |
aaaataaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 35005436 - 35005499
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35005436 |
aaaaaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 35307713 - 35307772
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35307713 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
35307772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 151 - 210
Target Start/End: Complemental strand, 47819600 - 47819541
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47819600 |
taaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 3247189 - 3247255
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3247189 |
aaaaaaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
3247255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 14007488 - 14007546
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
14007546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 32454295 - 32454237
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32454295 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgta |
32454237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 38164298 - 38164240
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38164298 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 50429210 - 50429152
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50429210 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
50429152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 50799129 - 50799187
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50799129 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
50799187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 990086 - 990143
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
990086 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
990143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 21391095 - 21391152
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21391095 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
21391152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 29072862 - 29072805
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgta |
29072805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 29688435 - 29688374
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29688435 |
aaatgaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct |
29688374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 35005745 - 35005692
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35005745 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 38151212 - 38151155
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
38151155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 44641079 - 44641132
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 44641432 - 44641375
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
44641375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 48956066 - 48956009
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgta |
48956009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 52254479 - 52254422
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
52254422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 13260322 - 13260266
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13260322 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 19720709 - 19720769
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19720709 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
19720769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 32626526 - 32626586
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
32626526 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
32626586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 33234543 - 33234603
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33234543 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
33234603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 34002943 - 34002883
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
34002943 |
aaaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgta |
34002883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 44157696 - 44157752
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
44157752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 45290821 - 45290765
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45290821 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
45290765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 47819231 - 47819287
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47819231 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 48609233 - 48609293
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
48609233 |
aaaggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgta |
48609293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 149 - 212
Target Start/End: Original strand, 4323822 - 4323885
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
4323822 |
aataaaagctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgta |
4323885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 12360970 - 12360911
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12360970 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
12360911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 15526370 - 15526307
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15526370 |
aaaatcaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 19622654 - 19622709
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19622654 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
19622709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 24649350 - 24649405
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg |
24649405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 24653802 - 24653857
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 37545628 - 37545683
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 8140433 - 8140491
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8140433 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
8140491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 10631531 - 10631473
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10631531 |
aaaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 11822366 - 11822308
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11822366 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgta |
11822308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 13259987 - 13260045
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13259987 |
aggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgta |
13260045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 153 - 211
Target Start/End: Original strand, 17984331 - 17984389
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17984331 |
aaggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtctctgt |
17984389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 18900130 - 18900076
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgta |
18900076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 24649661 - 24649603
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24649661 |
aggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
24649603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 26324584 - 26324642
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26324584 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
26324642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 27521567 - 27521633
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27521567 |
aaaaaaaaaagctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
27521633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 30322926 - 30322984
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30322926 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 39747836 - 39747778
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39747836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
39747778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 48609595 - 48609537
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
48609595 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcactgta |
48609537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 8140801 - 8140744
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8140801 |
aaggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 10631164 - 10631221
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
10631221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 16060885 - 16060828
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
16060828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 26191359 - 26191416
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgta |
26191416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 26191734 - 26191677
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
26191677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 26442563 - 26442620
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccatgta |
26442620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 33000305 - 33000362
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgta |
33000362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 38163929 - 38163986
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38163929 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 41881091 - 41881148
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
41881091 |
aaggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg |
41881148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 152 - 209
Target Start/End: Complemental strand, 44158045 - 44157988
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44158045 |
aaaggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct |
44157988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 2939934 - 2939986
Alignment:
| Q |
160 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgta |
2939986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 3247559 - 3247507
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 155 - 211
Target Start/End: Complemental strand, 3679986 - 3679930
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt |
3679930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 15516581 - 15516637
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15516581 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 16026939 - 16026883
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16026939 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 146 - 210
Target Start/End: Complemental strand, 24654176 - 24654112
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24654176 |
aaaaagaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
24654112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 30323294 - 30323238
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30323294 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg |
31258647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 35056895 - 35056839
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35056895 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 146 - 210
Target Start/End: Original strand, 38150839 - 38150903
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| ||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38150839 |
aaaaaaaaaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 39303675 - 39303731
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgta |
39303731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 41358664 - 41358608
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
41358664 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
41358608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 45380271 - 45380327
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45380271 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 48955713 - 48955765
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48955713 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 4789310 - 4789365
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
4789365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 5058998 - 5058935
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
5058998 |
aataaaggttaaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgta |
5058935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 10887599 - 10887544
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10887599 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 206
Target Start/End: Complemental strand, 17984701 - 17984650
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 18899837 - 18899896
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
18899837 |
aaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
18899896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 149 - 212
Target Start/End: Original strand, 21383098 - 21383161
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
21383098 |
aatataggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgta |
21383161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 24507479 - 24507534
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 24977778 - 24977833
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 35056530 - 35056585
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 38136981 - 38136926
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 40718110 - 40718165
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 45368847 - 45368792
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgta |
45368792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 45380636 - 45380581
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 45638580 - 45638635
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 46868577 - 46868522
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
46868522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 7819104 - 7819046
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7819104 |
aggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgta |
7819046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 7867128 - 7867186
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
7867128 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgta |
7867186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 15335292 - 15335238
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgta |
15335238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 16060587 - 16060652
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
16060587 |
aaaattaaaggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtcactgta |
16060652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 18079664 - 18079618
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18079664 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 22919978 - 22919920
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||| |||| |
|
|
| T |
22919978 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtccttgta |
22919920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 26324948 - 26324890
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26324948 |
aggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctgta |
26324890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 33045354 - 33045412
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33045354 |
aggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgta |
33045412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 34808200 - 34808254
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgta |
34808254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 37624744 - 37624798
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37624744 |
aaggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 147 - 209
Target Start/End: Original strand, 49073683 - 49073745
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||| ||||||||||||||| ||||| |
|
|
| T |
49073683 |
aaaataaaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 156 - 205
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 12322970 - 12322913
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgta |
12322913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 204
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 26207270 - 26207335
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||| ||||||||||||||| |||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
26207270 |
aaaaaaaagactaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgta |
26207335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 33234912 - 33234855
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgta |
33234855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 41738796 - 41738853
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgta |
41738853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 10887232 - 10887288
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10887232 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 15058419 - 15058475
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccttgta |
15058475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 15211508 - 15211568
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
15211508 |
aaaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgta |
15211568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 18079395 - 18079455
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||||| |||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
18079395 |
aaaggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgta |
18079455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 21391378 - 21391318
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||| ||||||||| |||| |
|
|
| T |
21391378 |
taaaggttaaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctgt |
21391318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 41739121 - 41739066
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41739121 |
aggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgta |
41739066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 4360628 - 4360569
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
4360628 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctgta |
4360569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 7867359 - 7867300
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
7867359 |
aaggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgta |
7867300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 17129691 - 17129746
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgta |
17129746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 24978128 - 24978065
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
24978128 |
aataaaggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgta |
24978065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 31060787 - 31060842
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 46183686 - 46183737
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
46183737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 152 - 209
Target Start/End: Original strand, 292858 - 292913
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
292858 |
aaaggctaaaat--ggttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 7350421 - 7350475
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
7350421 |
aaggttaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 12360602 - 12360660
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| ||||||| ||||||| |
|
|
| T |
12360602 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctgta |
12360660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 25658310 - 25658244
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25658310 |
aaaaataaagactaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctgta |
25658244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 156 - 210
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 39025381 - 39025328
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 42482978 - 42483036
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
42482978 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgta |
42483036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 50428872 - 50428930
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgta |
50428930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 152 - 209
Target Start/End: Original strand, 16026570 - 16026627
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16026570 |
aaaggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccct |
16026627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 16083045 - 16083098
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
16083045 |
aaggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 150 - 203
Target Start/End: Complemental strand, 17130088 - 17130035
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
17130088 |
ataaagactaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 20948755 - 20948812
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||||||| |||||||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgta |
20948812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 25658014 - 25658071
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| ||||||||||||||| |||||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgta |
25658071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 31061153 - 31061096
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31061153 |
aaggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 33067347 - 33067400
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||| |||| |
|
|
| T |
33067347 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 45638895 - 45638846
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
45638895 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 16083394 - 16083342
Alignment:
| Q |
160 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagtctctgta |
16083342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 34382948 - 34383003
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagtctctgta |
34383003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 46868223 - 46868283
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
46868223 |
aaaggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtctctgta |
46868283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 15211858 - 15211803
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||| | |||||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg |
15211803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 40718474 - 40718419
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg |
40718419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 48730615 - 48730560
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtccttgta |
48730560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 4565337 - 4565279
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
4565337 |
aggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgta |
4565279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 7350733 - 7350679
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |||||||||||||||||||| |||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtccttgta |
7350679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 147 - 205
Target Start/End: Complemental strand, 15058774 - 15058716
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
15058774 |
aaaaaaaaggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 21383429 - 21383371
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
21383429 |
aggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgta |
21383371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 26062261 - 26062203
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| ||| ||||||||||||| |||| |
|
|
| T |
26062261 |
aaaggttaaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctg |
26062203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 26142419 - 26142477
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||| || | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
26142419 |
aggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtcactgta |
26142477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 28507459 - 28507401
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
28507459 |
aggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgta |
28507401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 49923819 - 49923761
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
49923819 |
aggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgta |
49923761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 1159839 - 1159782
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||| | ||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
1159839 |
ggctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctgta |
1159782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 33380257 - 33380204
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccc-tgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
33380257 |
ggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcc |
33380204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 39747472 - 39747528
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
39747472 |
aaggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 202
Target Start/End: Complemental strand, 42483273 - 42483224
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| | ||||||||||| |
|
|
| T |
42483273 |
aaggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 8364917 - 8364861
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
8364917 |
aggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 172 - 212
Target Start/End: Original strand, 18302070 - 18302110
Alignment:
| Q |
172 |
agtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18302070 |
agtccctgcaaatatgtctcgttttggttttagtccctgta |
18302110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 19198948 - 19198892
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgta |
19198892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 140 - 212
Target Start/End: Original strand, 20756004 - 20756076
Alignment:
| Q |
140 |
atgaataaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||| |||| ||||||||| ||||| ||| || ||||||| ||||||||||||||||||| |||| |
|
|
| T |
20756004 |
atgaaaaaaaattaaggttaaaatatgattttaatccttgtaaatatgtctcgttttggttttagtccttgta |
20756076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 22674202 - 22674254
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
22674202 |
aggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 33067729 - 33067673
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| ||||||||||||||| | |||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaattcctgta |
33067673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 37625026 - 37624970
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||| ||||| ||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtctctgta |
37624970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 8364614 - 8364673
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
8364614 |
aaggttaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgta |
8364673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 12361371 - 12361317
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12361371 |
aaggctaaaatatgattttagtccctgca-----gcctcgttttggttttagtccctgta |
12361317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 29579322 - 29579377
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctgta |
29579377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 197
Target Start/End: Original strand, 36912852 - 36912895
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
36912852 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 210
Target Start/End: Original strand, 47038862 - 47038921
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| || |||| |||||| ||||||| |
|
|
| T |
47038862 |
taaaggctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctg |
47038921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 205
Target Start/End: Complemental strand, 24510308 - 24510258
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||| |||||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 26699607 - 26699550
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
26699607 |
aggctaaaatatggttttggtcc-tgcaaatatgcttcgtttttgttttagtctctgta |
26699550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 34002632 - 34002682
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
34002632 |
aaaggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 34383249 - 34383187
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||| ||||||| |||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
34383249 |
ataatggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctgta |
34383187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 37646733 - 37646799
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||| |||||| | || |||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
37646733 |
aaaagtaaaggcttaaatattgcattcgtccctgcaaatatgcttcgttttgattttagtccctgta |
37646799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 39025107 - 39025161
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
39025107 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 4324170 - 4324109
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| ||||||||| ||||||| | |||||||||| ||||||||||||||| ||| |||| |
|
|
| T |
4324170 |
taaaggttaaaatatgattttagttcatgcaaatatgtctcgttttggttttaatccttgta |
4324109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 12322604 - 12322661
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtccttgta |
12322661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 211
Target Start/End: Complemental strand, 14007876 - 14007819
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||| |||||||| || | |||||||||||||||| ||||||||| |||| |
|
|
| T |
14007876 |
aggctaaaatatagttttagtacccgtaaatatgcctcgttttagttttagtctctgt |
14007819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 15334916 - 15334965
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||| ||||||||||||||| |
|
|
| T |
15334916 |
aggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta |
15334965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 15466132 - 15466189
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||| | | ||||||||| |||||||||||||||||||| |
|
|
| T |
15466132 |
ggctaaaatatggttttggtccttacggatatgcctcattttggttttagtccctgta |
15466189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 197
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
197 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 4789639 - 4789587
Alignment:
| Q |
160 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||| |||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
4789639 |
aaatttggttttggtccctgcaaatatgcatcattttggttttggtccctgta |
4789587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 18928141 - 18928089
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||| |||| ||||||||||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtccc |
18928089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 30962415 - 30962471
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
30962415 |
aggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
30962471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 31404723 - 31404667
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||| |||| ||| |||||| | ||||||||||||| |
|
|
| T |
31404723 |
aggctaaaatatggttttggtccctacaaacatgtctcgttgttgttttagtccctg |
31404667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 4617091 - 4617145
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||| ||||||||| ||||| |
|
|
| T |
4617091 |
taaaatatggttttggtccctgaaaatatgtttcgttttagttttagtctctgta |
4617145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 202
Target Start/End: Complemental strand, 7350663 - 7350629
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
7350663 |
ttttggtccctgcaaatatgcctcgttttggtttt |
7350629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 10887306 - 10887348
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
10887306 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
10887348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 26324874 - 26324832
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
26324874 |
ttttggtccctgcaaatatgtctcgttttggttttcgtccctg |
26324832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 202
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
28507188 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28507222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 32035442 - 32035488
Alignment:
| Q |
161 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
32035442 |
aatatggttttgatctctgcaaatatgtctcgttttggttttagtcc |
32035488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 32035789 - 32035747
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
196 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||| |
|
|
| T |
32035789 |
aggctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 183
Target Start/End: Complemental strand, 41881348 - 41881318
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41881348 |
aaggctaaaatatggttttagtccctgcaaa |
41881318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 46183757 - 46183799
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
46183757 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
46183799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 187
Target Start/End: Complemental strand, 1811236 - 1811203
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatg |
187 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
1811236 |
aggctaaaatatgattttagtccctgcaaatatg |
1811203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 187
Target Start/End: Complemental strand, 2604187 - 2604154
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatg |
187 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
2604187 |
aggctaaaatatgtttttagtccctgcaaatatg |
2604154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 4360299 - 4360343
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||||||||| |
|
|
| T |
4360299 |
taaaatatggttttagtcc-tgcaaatatgtcttgttttggtttta |
4360343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 146 - 179
Target Start/End: Original strand, 7001603 - 7001636
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctg |
179 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
7001603 |
aaaaaaaaaggctaaaatatggttttagtccctg |
7001636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 186
Target Start/End: Complemental strand, 20723752 - 20723716
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
20723752 |
ataaaggctaaaatatgtttttggtccctgcaaatat |
20723716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 24509963 - 24509999
Alignment:
| Q |
176 |
cctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24509963 |
cctgcaaatatgtttcgttttggttttagtccctgta |
24509999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 49074054 - 49074006
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
|||||||||||||||||| |||| || |||||||| |||||||| |||| |
|
|
| T |
49074054 |
aggctaaaatatggttttggtccttgtaaatatgcttcgttttgatttt |
49074006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 178
Target Start/End: Complemental strand, 49226572 - 49226544
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49226572 |
ataaaggctaaaatatggttttagtccct |
49226544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 2e-26; HSPs: 157)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 150 - 210
Target Start/End: Complemental strand, 15076209 - 15076149
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15076209 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15076149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 150 - 212
Target Start/End: Original strand, 21995059 - 21995121
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21995059 |
ataaaggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgta |
21995121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 33801746 - 33801688
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33801746 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33801688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 15962389 - 15962332
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
15962332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 24274133 - 24274076
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24274133 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24274076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 34582529 - 34582586
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
34582586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 7156161 - 7156105
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156161 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7156105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 30928678 - 30928738
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30928678 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
30928738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 151 - 210
Target Start/End: Complemental strand, 22822655 - 22822596
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22822655 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
22822596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 31166862 - 31166925
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31166862 |
aaaaaaaaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
31166925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 1007510 - 1007452
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1007510 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
1007452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 3414386 - 3414444
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3414386 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
3414444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 3969010 - 3968952
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3969010 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
3968952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 7155794 - 7155852
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7155794 |
aaaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7155852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 8681119 - 8681061
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8681119 |
aaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
8681061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 12299149 - 12299083
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12299149 |
aaaaatgaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgta |
12299083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 25137358 - 25137300
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25137358 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
25137300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 25431855 - 25431797
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25431855 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
25431797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 26376042 - 26375988
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
26375988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 34582893 - 34582835
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34582893 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgta |
34582835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 494405 - 494462
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
494462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 2373175 - 2373236
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
2373175 |
taaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgta |
2373236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 146 - 211
Target Start/End: Original strand, 6468301 - 6468366
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
6468301 |
aaaaaaaaaggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgt |
6468366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 19296407 - 19296350
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
19296350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 30929044 - 30928987
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30928987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 1890453 - 1890397
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1890453 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
1890397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 3356139 - 3356199
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
3356139 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccttgta |
3356199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 8680774 - 8680830
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8680774 |
aggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8680830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 12419939 - 12419883
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12419939 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
12419883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 14428651 - 14428707
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
14428707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 14655378 - 14655434
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14655378 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
14655434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 15962026 - 15962082
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15962026 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 19690390 - 19690450
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19690390 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
19690450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 148 - 212
Target Start/End: Original strand, 21147397 - 21147461
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21147397 |
aaatataggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgta |
21147461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 21994404 - 21994348
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21994404 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 22543353 - 22543409
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22543353 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 22792902 - 22792846
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792902 |
aaaggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
22792846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 23770162 - 23770218
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
23770218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 25136991 - 25137051
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25136991 |
aaaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgta |
25137051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 32885672 - 32885728
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32885672 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
32885728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 33131853 - 33131793
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33131853 |
aaaggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgta |
33131793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 159 - 210
Target Start/End: Original strand, 543365 - 543416
Alignment:
| Q |
159 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
543416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 1890051 - 1890114
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
1890051 |
aaaataaaggttaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
1890114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 2615871 - 2615926
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2615871 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 158 - 209
Target Start/End: Complemental strand, 3356495 - 3356444
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3356444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 6412587 - 6412524
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6412587 |
aaaattaaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 11449171 - 11449112
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11449171 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgta |
11449112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 23502542 - 23502483
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
23502542 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgta |
23502483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 34990317 - 34990258
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34990317 |
aaggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
34990258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 1007123 - 1007181
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1007123 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgta |
1007181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 7324189 - 7324135
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
7324135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 10910965 - 10910907
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10910965 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
10910907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 12176640 - 12176586
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
12176586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 12612360 - 12612302
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12612360 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgta |
12612302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 21385248 - 21385306
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21385248 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 21385587 - 21385529
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21385587 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 24273825 - 24273883
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
24273825 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 3968643 - 3968700
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3968643 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
5286896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 12419707 - 12419760
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12419707 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 17771911 - 17771968
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgta |
17771968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 19296104 - 19296165
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
19296104 |
taaaggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgta |
19296165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 21995425 - 21995368
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgta |
21995368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 6412217 - 6412273
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6412217 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 153 - 209
Target Start/End: Original strand, 13268107 - 13268163
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13268107 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct |
13268163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 20467719 - 20467663
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20467719 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 22543719 - 22543663
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22543719 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 24692980 - 24692924
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
24692980 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 33808619 - 33808675
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
33808619 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
33808675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 3276356 - 3276297
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
3276356 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgta |
3276297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 11448535 - 11448590
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11448535 |
aaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccc |
11448590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 12757608 - 12757667
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
12757608 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgta |
12757667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 13617531 - 13617586
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgta |
13617586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 14656262 - 14656203
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
14656262 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgta |
14656203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 19129328 - 19129391
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||| |||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19129328 |
aaaatataggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg |
19129391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 19321132 - 19321081
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19321132 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 151 - 210
Target Start/End: Original strand, 20467347 - 20467406
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20467347 |
taaaggataaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 26375691 - 26375750
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
26375691 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgta |
26375750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 31167200 - 31167145
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg |
31167145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 317811 - 317869
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
317811 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctgta |
317869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 318098 - 318040
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
318098 |
aggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgta |
318040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 777674 - 777732
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
777674 |
aaaggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg |
777732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 3414755 - 3414697
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3414755 |
aaaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 207
Target Start/End: Complemental strand, 9896639 - 9896585
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
9896639 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 10091039 - 10091093
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
10091093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 18024376 - 18024318
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
18024376 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgta |
18024318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 21993786 - 21993844
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21993786 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgta |
21993844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 23502234 - 23502284
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23502234 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 494760 - 494695
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||| |
|
|
| T |
494760 |
aaaaaaaaagctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgta |
494695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 202
Target Start/End: Complemental strand, 2616242 - 2616193
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2616242 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 6591113 - 6591162
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6591113 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 13150758 - 13150693
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13150758 |
aaaaaaaaggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgta |
13150693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 152 - 205
Target Start/End: Original strand, 17765006 - 17765059
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
17765006 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 152 - 205
Target Start/End: Original strand, 22822304 - 22822357
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
22822304 |
aaaggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 31186591 - 31186534
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgta |
31186534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 8170152 - 8170100
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
8170152 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 155 - 211
Target Start/End: Original strand, 19267565 - 19267621
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgt |
19267621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 30479421 - 30479365
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| || | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgta |
30479365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 778043 - 777992
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
778043 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 14428948 - 14428893
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccttgta |
14428893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 206
Target Start/End: Original strand, 24901239 - 24901290
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 31398543 - 31398484
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
31398543 |
aaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtccttgta |
31398484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 156 - 207
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 18024014 - 18024068
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgta |
18024068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 19129521 - 19129463
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
19129521 |
aggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgta |
19129463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 23770440 - 23770398
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23770440 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 25121497 - 25121439
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25121497 |
aggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgta |
25121439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 30239293 - 30239347
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 10910629 - 10910686
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||| || |||||||| |||||||||||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgta |
10910686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 167 - 212
Target Start/End: Complemental strand, 13617804 - 13617759
Alignment:
| Q |
167 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
13617759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 17765379 - 17765318
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
17765379 |
taaaggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgta |
17765318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 19320759 - 19320824
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||| | ||||||||||||||| ||||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
19320759 |
aaaataatgactaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgta |
19320824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 543725 - 543669
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
543725 |
aggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctg |
543669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 212
Target Start/End: Complemental strand, 15117054 - 15116984
Alignment:
| Q |
140 |
atgaataaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||| |
|
|
| T |
15117054 |
atgattaaaaataa-ggctaaaatatggttttagtccctgcaaatatgcctc-ctttgattttagtccatgta |
15116984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 1214997 - 1214942
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
1214997 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 147 - 209
Target Start/End: Original strand, 6564573 - 6564636
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttag-tccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||| |||||||| ||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6564573 |
aaaatataggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 9896280 - 9896335
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctgta |
9896335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 202
Target Start/End: Complemental strand, 11129543 - 11129496
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11129543 |
ggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 12298825 - 12298876
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 1875501 - 1875559
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| | |||| ||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
1875501 |
aggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctgta |
1875559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 6564944 - 6564887
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
6564944 |
aggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtctctgta |
6564887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 15722609 - 15722667
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
15722609 |
aggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgta |
15722667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 19276036 - 19275982
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||| |||||||||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
19276036 |
taaaatatagttttagtccctacaaatatacctcattttggttttagtccctgta |
19275982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 150 - 212
Target Start/End: Original strand, 7323859 - 7323925
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagt----ccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| | || |||||||||| |||||||||||||||||||||||| |
|
|
| T |
7323859 |
ataaaggctaaaatatggttttaattagcccttgcaaatatgtctcgttttggttttagtccctgta |
7323925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 12176377 - 12176442
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||| ||||||||||||||||||| || || ||||||| |||||||| |||||||||| |||| |
|
|
| T |
12176377 |
aaaataatggctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagtccatgta |
12176442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 14655903 - 14655960
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgta |
14655960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 31276344 - 31276283
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||| ||||| ||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
31276344 |
taaaagctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgta |
31276283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 209
Target Start/End: Original strand, 1214694 - 1214750
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| | | ||||||||||||||||| |
|
|
| T |
1214694 |
aaggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 15116672 - 15116721
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
15116672 |
aggctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagt |
15116721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 19267915 - 19267855
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| || |||| ||||||| | | |||||||||||||||||||| |
|
|
| T |
19267915 |
aaaggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgta |
19267855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 23628799 - 23628855
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcactgta |
23628855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 12611995 - 12612045
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
12611995 |
ggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagt |
12612045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 24901555 - 24901497
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
24901555 |
aggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgta |
24901497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 11925739 - 11925796
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
11925739 |
ggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtctctgta |
11925796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 19690755 - 19690703
Alignment:
| Q |
159 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgtttt-gttttagtccgtgta |
19690703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 25121183 - 25121234
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
25121183 |
aggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagtc |
25121234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 200
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| |||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 31276105 - 31276157
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||| |||||| |||||||||||| |||||||||| ||||||| |
|
|
| T |
31276105 |
taaactatggttttggtccctacaaatatgcctcattttggttttggtccctg |
31276157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Complemental strand, 11926034 - 11925983
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||||| ||| ||| ||||||| | ||||||||||||||| |
|
|
| T |
11926034 |
aggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt |
11925983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 25431574 - 25431633
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||||||| |||||||| ||||||| |||||| |
|
|
| T |
25431574 |
aaggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctgta |
25431633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 200
Target Start/End: Complemental strand, 32885960 - 32885921
Alignment:
| Q |
161 |
aatatggttttagtccctgcaaatatgcctcgttttggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
32885960 |
aatatggttttagtccctgcaaatatgtctcattttggtt |
32885921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 1007197 - 1007239
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
1007197 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1007239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 1214767 - 1214809
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
1214767 |
ttttggtccctgcaaatatgtcttgttttggttttagtccctg |
1214809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 13268182 - 13268224
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
13268182 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
13268224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 15722901 - 15722843
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||||||| || |||||||||||| ||||| |
|
|
| T |
15722901 |
aggctaaaatatagttttgattcctgcaaatatgccttgtgttggttttagtctctgta |
15722843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 19129447 - 19129405
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
19129447 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
19129405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 205
Target Start/End: Original strand, 19275032 - 19275090
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||| ||| ||||||||||||||| | ||||| ||||| |||||||||||||||| |
|
|
| T |
19275032 |
aaaataagggcaaaaatatggttttaggctctgcagatatgtttcgttttggttttagt |
19275090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 206
Target Start/End: Complemental strand, 19275223 - 19275185
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
19275185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 24901311 - 24901353
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
24901311 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24901353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 25137066 - 25137108
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
25137066 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
25137108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 200
Target Start/End: Original strand, 30479062 - 30479108
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| | |||||||||| |
|
|
| T |
30479062 |
aggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 31198688 - 31198730
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
31198688 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
31198730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 17765302 - 17765261
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
17765302 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
17765261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 207
Target Start/End: Original strand, 5286606 - 5286638
Alignment:
| Q |
175 |
ccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
5286606 |
ccctgcaaatatgcctcgttttgattttagtcc |
5286638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 235)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 13064468 - 13064408
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13064468 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
13064408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 16712694 - 16712634
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16712694 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
16712634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 43231395 - 43231332
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43231395 |
aataaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
43231332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 52017503 - 52017562
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52017503 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
52017562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 52017872 - 52017813
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52017872 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
52017813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 13530717 - 13530656
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13530717 |
taaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
13530656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 24774037 - 24774102
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24774037 |
aaaaaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
24774102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 146 - 211
Target Start/End: Original strand, 27008075 - 27008140
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27008075 |
aaaaataatggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27008140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 29463917 - 29463856
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29463917 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgta |
29463856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 149 - 210
Target Start/End: Complemental strand, 30046798 - 30046737
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30046798 |
aataaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 149 - 210
Target Start/End: Complemental strand, 30061139 - 30061078
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30061139 |
aataaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 41345851 - 41345908
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41345851 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41345908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 53717174 - 53717117
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
53717117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 2034858 - 2034798
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2034858 |
aaaggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgta |
2034798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 153 - 209
Target Start/End: Original strand, 18205154 - 18205210
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18205154 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18205210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 153 - 209
Target Start/End: Original strand, 32208540 - 32208596
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32208540 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
32208596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 35763646 - 35763702
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35763646 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 38054543 - 38054603
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38054543 |
aaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
38054603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 46292658 - 46292594
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
46292658 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgta |
46292594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 2180218 - 2180277
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2180218 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
2180277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 146 - 209
Target Start/End: Complemental strand, 28809189 - 28809126
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28809189 |
aaaaaaaaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 151 - 210
Target Start/End: Original strand, 29499178 - 29499237
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29499178 |
taaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 35415633 - 35415578
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35415578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 152 - 211
Target Start/End: Complemental strand, 45505897 - 45505838
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45505897 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
45505838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 55072387 - 55072446
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55072387 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
55072446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 139 - 212
Target Start/End: Complemental strand, 5827990 - 5827916
Alignment:
| Q |
139 |
catgaataaa-aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5827990 |
catgaataaagaaaaaaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgta |
5827916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 13064158 - 13064216
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13064158 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
13064216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 13479612 - 13479554
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13479612 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
13479554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 153 - 211
Target Start/End: Complemental strand, 32365485 - 32365427
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32365485 |
aaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
32365427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 153 - 211
Target Start/End: Original strand, 45505598 - 45505656
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45505598 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
45505656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 51545966 - 51545912
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
51545912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 5052588 - 5052527
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5052588 |
taaaggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
5052527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 6827876 - 6827819
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6827876 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
6827819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 149 - 210
Target Start/End: Original strand, 9289260 - 9289321
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9289260 |
aatataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 149 - 210
Target Start/End: Complemental strand, 14791812 - 14791751
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14791812 |
aataaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 22099543 - 22099600
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
22099600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 24474970 - 24474909
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24474970 |
aaatgaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 32365093 - 32365150
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32365093 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
32365150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 46115414 - 46115471
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
46115471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 46128548 - 46128605
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
46128605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 123533 - 123589
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
123533 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
123589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 8760784 - 8760724
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
8760784 |
aaaggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgta |
8760724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 11285504 - 11285560
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
11285560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 22099919 - 22099855
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
22099919 |
aaattaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgta |
22099855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 153 - 205
Target Start/End: Original strand, 23778962 - 23779014
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23778962 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 25424315 - 25424255
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25424315 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
25424255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 29380913 - 29380853
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
29380913 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
29380853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 146 - 210
Target Start/End: Original strand, 35415290 - 35415354
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
35415290 |
aaaaatataggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
35415354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 41619902 - 41619954
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41619954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 46088061 - 46088005
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46088061 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 146 - 210
Target Start/End: Complemental strand, 50714574 - 50714510
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50714574 |
aaaagtaatggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
50714510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 9445951 - 9446006
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
9446006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 23245231 - 23245286
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 25423922 - 25423981
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25423922 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
25423981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 34361801 - 34361860
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
34361801 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
34361860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 35464382 - 35464327
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 36701998 - 36702057
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
36701998 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
36702057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 42848391 - 42848336
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 151 - 210
Target Start/End: Original strand, 43231084 - 43231143
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43231084 |
taaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 50714240 - 50714295
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50714295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 51545627 - 51545686
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
51545627 |
aaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctctgta |
51545686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 52442094 - 52442035
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
52442094 |
aaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgta |
52442035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 54903477 - 54903418
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54903477 |
aaggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
54903418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 5882551 - 5882608
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5882551 |
aggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctgta |
5882608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 12791975 - 12791917
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12791975 |
aggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgta |
12791917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 13631227 - 13631285
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13631227 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13631285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 14487801 - 14487859
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14487801 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgta |
14487859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 35464017 - 35464075
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35464017 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35464075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 46115782 - 46115724
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
46115782 |
aaaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 46128916 - 46128858
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
46128916 |
aaaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 52430101 - 52430043
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
52430101 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgta |
52430043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 52441762 - 52441820
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
52441762 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
52441820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 55072709 - 55072655
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
55072655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 4279343 - 4279278
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
4279343 |
aaaataatggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttgta |
4279278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 6827544 - 6827597
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6827544 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 8191391 - 8191334
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgta |
8191334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 13073759 - 13073816
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13073816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 13631601 - 13631544
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13631601 |
aaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 29499548 - 29499491
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29499548 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 41620258 - 41620201
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
41620258 |
aaggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
41620201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 42848023 - 42848084
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42848023 |
taaaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgta |
42848084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 45474604 - 45474539
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
45474604 |
aaaattaaggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctctgta |
45474539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 51709029 - 51708976
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51709029 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 55482468 - 55482411
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgta |
55482411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 4211560 - 4211616
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4211560 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
4211616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 6353637 - 6353581
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgta |
6353581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 9289640 - 9289584
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9289640 |
aggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 146 - 210
Target Start/End: Original strand, 26412181 - 26412245
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26412181 |
aaaaatataggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 27008401 - 27008349
Alignment:
| Q |
160 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgta |
27008349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 31812220 - 31812156
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31812220 |
aaatcaaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgta |
31812156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 32208903 - 32208847
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32208903 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 35119289 - 35119349
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35119289 |
aaaggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgta |
35119349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 35763956 - 35763900
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35763956 |
aggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctg |
35763900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 36702362 - 36702306
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgta |
36702306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 43368462 - 43368522
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43368462 |
aaagactaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
43368522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 51708692 - 51708744
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51708692 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 53915682 - 53915738
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53915682 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 8760602 - 8760661
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8760602 |
aaggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgta |
8760661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 18205521 - 18205466
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
18205466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 26412584 - 26412529
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 29420538 - 29420483
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29420538 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 36054152 - 36054093
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36054152 |
aaggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
36054093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 46292392 - 46292447
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 2322441 - 2322375
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
2322441 |
aaaaaaaaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgta |
2322375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 4279021 - 4279079
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4279021 |
aggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgta |
4279079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 11693122 - 11693064
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11693122 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgta |
11693064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 12152494 - 12152436
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
12152494 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgta |
12152436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 13074126 - 13074068
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
13074126 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttgta |
13074068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 14488188 - 14488130
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
14488188 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
14488130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 20291985 - 20292043
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20291985 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtctctgta |
20292043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 22584286 - 22584344
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||| |
|
|
| T |
22584286 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctgta |
22584344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 22584608 - 22584550
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22584608 |
aggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgta |
22584550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 23245596 - 23245538
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23245596 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgta |
23245538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 211
Target Start/End: Complemental strand, 23779227 - 23779169
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
23779227 |
aaggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgt |
23779169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 26314341 - 26314275
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
26314341 |
aaaaaaaaaggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgta |
26314275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 29380665 - 29380723
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
29380665 |
aaaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctg |
29380723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 31560328 - 31560386
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31560328 |
aaaggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 34355284 - 34355226
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
34355284 |
aggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgta |
34355226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 45593227 - 45593285
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
45593227 |
aggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgta |
45593285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 45593587 - 45593529
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45593587 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgta |
45593529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 53716920 - 53716978
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
53716920 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgta |
53716978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 5827655 - 5827712
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
5827712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 13479273 - 13479326
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct |
13479326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 13764613 - 13764670
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgta |
13764670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 19321859 - 19321802
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgta |
19321802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 27427870 - 27427926
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27427870 |
aaggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 28809011 - 28809068
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgta |
28809068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 30564829 - 30564890
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
30564829 |
taaagactaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgta |
30564890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 31560695 - 31560638
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
31560638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 41324890 - 41324833
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgta |
41324833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 41346219 - 41346166
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
41346219 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
41346166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 53308068 - 53308011
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgta |
53308011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 123893 - 123845
Alignment:
| Q |
160 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
123845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 2034544 - 2034596
Alignment:
| Q |
160 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
2034596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 2322094 - 2322150
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgta |
2322150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 18136116 - 18136056
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18136116 |
aaaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgta |
18136056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 28448833 - 28448885
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
28448833 |
aggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 31182507 - 31182447
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
31182507 |
aaaggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgta |
31182447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 36050289 - 36050345
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgta |
36050345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 37557194 - 37557138
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgta |
37557138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 44925844 - 44925788
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| ||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgta |
44925788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 49123324 - 49123264
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49123324 |
aaaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgta |
49123264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 53916048 - 53915992
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
53916048 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 152 - 203
Target Start/End: Original strand, 8904883 - 8904934
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8904883 |
aaaggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 16712331 - 16712386
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtctctgta |
16712386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 18831176 - 18831121
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgta |
18831121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 19903653 - 19903598
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgta |
19903598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 31811923 - 31811982
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31811923 |
aaggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgta |
31811982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 54208827 - 54208768
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
54208827 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgta |
54208768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 12152153 - 12152211
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
12152153 |
aggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgta |
12152211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 14791502 - 14791556
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgta |
14791556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 156 - 206
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 20144423 - 20144477
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctgta |
20144477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 24474599 - 24474656
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtccatgta |
24474656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 37556840 - 37556898
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
37556840 |
aggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgta |
37556898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 207
Target Start/End: Complemental strand, 41921086 - 41921032
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
41921086 |
aaggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 42823775 - 42823833
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
42823775 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgta |
42823833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 152 - 206
Target Start/End: Original strand, 44925482 - 44925536
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
44925482 |
aaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 51738136 - 51738194
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
51738136 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgta |
51738194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 2180572 - 2180515
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtccttgta |
2180515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 9446323 - 9446266
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgta |
9446266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcg-ttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct |
5202981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 13530378 - 13530434
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
13530378 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 19321569 - 19321625
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||| |||| ||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
19321569 |
aggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 203
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 153 - 209
Target Start/End: Original strand, 47022738 - 47022794
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
47022738 |
aaggataaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 47023106 - 47023050
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47023106 |
aggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 47136170 - 47136114
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgta |
47136114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 51738412 - 51738356
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
51738412 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 51763201 - 51763145
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctgta |
51763145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 51830886 - 51830946
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
51830886 |
aaagtctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctgta |
51830946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 11692761 - 11692816
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
11692761 |
aggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccct |
11692816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 13764809 - 13764750
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
13764809 |
aaggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtccatgta |
13764750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 20144733 - 20144674
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||||||||||| ||||||| |
|
|
| T |
20144733 |
aaggctaaaatatggttttggttcatgcaaatatgcctcgttttggttttaacccctgta |
20144674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 25358540 - 25358485
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 31370803 - 31370854
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
31370803 |
aggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt |
31370854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 35420393 - 35420448
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| | ||||||||||||||||||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgta |
35420448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 35420701 - 35420646
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||| ||||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgta |
35420646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 51762868 - 51762927
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
51762868 |
aaggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgta |
51762927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 5797484 - 5797538
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| |||| ||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgta |
5797538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 205
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 203
Target Start/End: Original strand, 52543420 - 52543470
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
52543420 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 14594205 - 14594258
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14594205 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 26313988 - 26314045
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgta |
26314045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 35119612 - 35119559
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
35119612 |
aggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 42824091 - 42824034
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||| ||||||||| |||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtccttgta |
42824034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 50753914 - 50753979
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||| |||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
50753914 |
aaaattaaggttaaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgta |
50753979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 212
Target Start/End: Original strand, 54208477 - 54208518
Alignment:
| Q |
171 |
tagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54208477 |
tagtccctgcaaatatgcctcattttggttttagtccctgta |
54208518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 5797817 - 5797765
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg |
5797765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 47532667 - 47532615
Alignment:
| Q |
160 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgta |
47532615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 50822297 - 50822237
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| ||| | ||| |||||||||||||| |
|
|
| T |
50822297 |
aaaggctaaaatatggttttactccatgcaaatatgtctcatgttgattttagtccctgta |
50822237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 28449216 - 28449157
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||| ||||| ||| |||| |
|
|
| T |
28449216 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttgattttaatccatgta |
28449157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 41920771 - 41920818
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| ||||||| |
|
|
| T |
41920771 |
taaaatatggttttagtccctgcaaatatgactcattttgattttagt |
41920818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 5063013 - 5063066
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
5063013 |
taaaatatg-ttttagtccctgcaaatataccttgttttggtttaagtccctgta |
5063066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 8905234 - 8905180
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| ||||| ||||| ||||| |
|
|
| T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct |
8905180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 19903260 - 19903318
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||| ||||| |||||||||||||| |
|
|
| T |
19903260 |
aggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgta |
19903318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 36050359 - 36050401
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
36050401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 7642652 - 7642595
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| || | ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7642652 |
ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctgta |
7642595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 18135793 - 18135841
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
18135793 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc |
18135841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 210
Target Start/End: Complemental strand, 25358499 - 25358454
Alignment:
| Q |
165 |
tggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| | ||||||| |
|
|
| T |
25358499 |
tggttttagtccctgcaaatatgtctcgttttggttgtggtccctg |
25358454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 34354972 - 34355022
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34354972 |
taaaatatagttttagtccctgca----tgcctcgttttggttttagtccctgta |
34355022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 43368777 - 43368720
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| | || ||||||||| |||||||||||||||| |||||| |
|
|
| T |
43368777 |
ggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctgta |
43368720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 49123000 - 49123048
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
49123000 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc |
49123048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 7639897 - 7639953
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| || |||||||||||| || ||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggttttaatctctgta |
7639953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 8191076 - 8191132
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| || ||||| ||||||||||||||| |
|
|
| T |
8191076 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgta |
8191132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 25358213 - 25358269
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
25358213 |
gctaaaatatgattttaatccatgcaaatatgcttcgttttggtttcagtccttgta |
25358269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 28197283 - 28197227
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||| ||||| || |||||||||||| |
|
|
| T |
28197283 |
aaggttaaaatatggttttagtctctacaaatatgtctcgtctttgttttagtccct |
28197227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 52543730 - 52543670
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||| |||| || | |||||||||||||||||||||||||| ||| |||| |
|
|
| T |
52543730 |
aaagcctaaaatatgattttggttcttgcaaatatgcctcgttttggttttaatccatgta |
52543670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 55805088 - 55805036
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||| ||||| || | ||||||||||||| |||||||||||||||| |
|
|
| T |
55805088 |
ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtcc |
55805036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 5797747 - 5797705
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
5797747 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
5797705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 11692834 - 11692876
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
11692834 |
ttttggtccctgcaaatatgcctcgttttgattttggtccctg |
11692876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 13530452 - 13530494
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
13530452 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
13530494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 20144492 - 20144534
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
20144492 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
20144534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 24774354 - 24774312
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
24774354 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24774312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 25424239 - 25424197
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
25424239 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
25424197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 31811996 - 31812038
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
31811996 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
31812038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 41439790 - 41439844
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| | ||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
41439790 |
taaaatatggttttagcctctgtaaatatttctcgttttggttttagtctctgta |
41439844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 47135851 - 47135893
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
47135851 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
47135893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 51763129 - 51763087
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
51763129 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
51763087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 14594494 - 14594453
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
14594494 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
14594453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 14594561 - 14594508
Alignment:
| Q |
159 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||| ||||||||||| ||||||| || |||||||||||||| |||||| |
|
|
| T |
14594561 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctgta |
14594508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 186
Target Start/End: Complemental strand, 29060947 - 29060910
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
29060947 |
aataaaggctaaaatatgtttttaatccctgcaaatat |
29060910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 210
Target Start/End: Complemental strand, 47023027 - 47022990
Alignment:
| Q |
173 |
gtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
47023027 |
gtccctgcaaatatgcctcattttggttttggtccctg |
47022990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 210
Target Start/End: Complemental strand, 54208747 - 54208710
Alignment:
| Q |
173 |
gtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
54208747 |
gtccctgcaaatatgcctcattttggttttggtccctg |
54208710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 54903107 - 54903168
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||||||| ||||||| |||||| | |||||| |
|
|
| T |
54903107 |
taaaggttaaaatatggttttgatccctacaaatatgcatcgttttagttttaattcctgta |
54903168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 54903403 - 54903362
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
54903403 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
54903362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 208
Target Start/End: Complemental strand, 2034781 - 2034741
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
2034781 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
2034741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 3653733 - 3653689
Alignment:
| Q |
162 |
atatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||| |||||||||||| |||||| ||| ||||||||||||||| |
|
|
| T |
3653733 |
atatgattttagtccctgtaaatataccttgttttggttttagtc |
3653689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 20292284 - 20292237
Alignment:
| Q |
159 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||| ||||| |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
20292284 |
aaaatatcgttttggtccctgcaa-tatgcctcattttggttttagtcc |
20292237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 183
Target Start/End: Original strand, 41324761 - 41324797
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaa |
183 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
41324761 |
aaaaaaaaggctaaaatatggttttggtccctgcaaa |
41324797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 186
Target Start/End: Complemental strand, 45619791 - 45619759
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
45619791 |
aggctaaaatatgtttttagtccctgcaaatat |
45619759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 186
Target Start/End: Complemental strand, 51831002 - 51830974
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51831002 |
taaaatatggttttagtccctgcaaatat |
51830974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 2e-26; HSPs: 261)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 4950034 - 4950094
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4950034 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
4950094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 4513261 - 4513320
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4513261 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
4513320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 25615966 - 25616032
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25615966 |
aaaattaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
25616032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 31480127 - 31480193
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31480127 |
aaaaaaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
31480193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 37507225 - 37507167
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37507225 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 20612900 - 20612843
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20612900 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
20612843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 25710870 - 25710813
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
25710813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 28427610 - 28427553
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28427610 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28427553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 30268497 - 30268562
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30268497 |
aaaatgaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30268562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 39437111 - 39437054
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39437111 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
39437054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 45320987 - 45320922
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45320987 |
aaaattaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
45320922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 51834606 - 51834663
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51834606 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51834663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 3152112 - 3152056
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3152112 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3152056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 37506866 - 37506922
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37506866 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37506922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 3151749 - 3151804
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3151749 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 5345691 - 5345632
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5345691 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
5345632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 10976978 - 10977033
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
10977033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 22008524 - 22008583
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22008524 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
22008583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 22016042 - 22016101
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22016042 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
22016101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 151 - 210
Target Start/End: Original strand, 39436714 - 39436773
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39436714 |
taaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39436773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 50196301 - 50196356
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
50196356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 3830133 - 3830191
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3830133 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
3830191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 3830517 - 3830459
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3830517 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgta |
3830459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 13584370 - 13584312
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13584370 |
aaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
13584312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 21159818 - 21159760
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21159818 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
21159760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22156238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 26799885 - 26799943
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26799885 |
aaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
26799943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 54608515 - 54608573
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608515 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 9863404 - 9863347
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgta |
9863347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 12741279 - 12741214
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12741279 |
aaaaaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
12741214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 16123139 - 16123196
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgta |
16123196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 19656533 - 19656598
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
19656533 |
aaaataaaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccttgta |
19656598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 28942907 - 28942850
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28942907 |
aaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
28942850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 29445954 - 29446011
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29446011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 30106228 - 30106163
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30106228 |
aaaatataggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgta |
30106163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 46186775 - 46186714
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46186775 |
taaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgta |
46186714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 49323782 - 49323839
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
49323839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 53701663 - 53701606
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
53701606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 12673641 - 12673701
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12673641 |
aaaggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgta |
12673701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 155 - 211
Target Start/End: Original strand, 15016388 - 15016444
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
15016444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 19844584 - 19844524
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19844584 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
19844524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 28552384 - 28552328
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28552384 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 39288899 - 39288843
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39288899 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
39288843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 45002388 - 45002328
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45002388 |
aaaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgta |
45002328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 47336588 - 47336524
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47336588 |
aaatataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
47336524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 51500686 - 51500630
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 51550081 - 51550137
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51550081 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 51834943 - 51834887
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51834943 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
51834887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 1721454 - 1721395
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1721454 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgta |
1721395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 4513622 - 4513563
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4513622 |
aaggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgta |
4513563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 8510214 - 8510269
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg |
8510269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 151 - 210
Target Start/End: Complemental strand, 8940529 - 8940470
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8940529 |
taaaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 22008890 - 22008835
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 29955300 - 29955355
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
29955355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 30004454 - 30004509
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
30004509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 146 - 209
Target Start/End: Original strand, 43440486 - 43440549
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
43440486 |
aaaaataaaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 46751269 - 46751328
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46751269 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgta |
46751328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 48924242 - 48924183
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48924242 |
aaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgta |
48924183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 9262156 - 9262102
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9262156 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 10977344 - 10977286
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10977344 |
aaaggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg |
10977286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 143 - 212
Target Start/End: Original strand, 11463219 - 11463289
Alignment:
| Q |
143 |
aataaaaataaag-gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11463219 |
aataaaaataaaaagctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgta |
11463289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 14633542 - 14633600
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14633542 |
aaagactaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctg |
14633600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 26090087 - 26090021
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| | ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26090087 |
aaaaattatggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
26090021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 28552020 - 28552078
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28552020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgta |
28552078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 29955667 - 29955609
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29955667 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
29955609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 30004822 - 30004764
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30004822 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
30004764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 30130157 - 30130215
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
30130157 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
30130215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 31869957 - 31869899
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
31869957 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgta |
31869899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 32119587 - 32119529
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32119587 |
aaaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 150 - 212
Target Start/End: Original strand, 35565503 - 35565565
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35565503 |
ataaaggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgta |
35565565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 43441606 - 43441548
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43441606 |
aaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 50196658 - 50196600
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
50196658 |
aggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgta |
50196600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 51550447 - 51550389
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51550447 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
51550389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 54608864 - 54608806
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54608864 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
54608806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 474042 - 474099
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
474042 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 4034717 - 4034774
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
4034774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 9261789 - 9261846
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
9261846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 20611018 - 20611071
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20611018 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 21159445 - 21159510
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
21159445 |
aaaaaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgta |
21159510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 34238597 - 34238650
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34238597 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34238650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 206
Target Start/End: Original strand, 39288571 - 39288624
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39288571 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 40370589 - 40370536
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 44802282 - 44802339
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgta |
44802339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 47336226 - 47336283
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47336226 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 52342591 - 52342526
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52342591 |
aaaattaaggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtccatgta |
52342526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 275443 - 275499
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
275443 |
aggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 3387607 - 3387547
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3387607 |
aaaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccatgta |
3387547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 149 - 209
Target Start/End: Original strand, 9603623 - 9603683
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9603623 |
aatataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct |
9603683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 12740906 - 12740962
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12740906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 22155928 - 22155984
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
22155928 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22155984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 28427244 - 28427300
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
28427244 |
aggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg |
28427300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 146 - 210
Target Start/End: Original strand, 40169335 - 40169399
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
40169335 |
aaaaaaaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg |
40169399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 40979713 - 40979653
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
40979713 |
aaaggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgta |
40979653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 45002020 - 45002076
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45002020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 51759816 - 51759876
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51759816 |
aaaggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgta |
51759876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 7518088 - 7518147
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
7518088 |
aaggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttgta |
7518147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 9597097 - 9597038
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9597097 |
aaggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgta |
9597038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 151 - 210
Target Start/End: Complemental strand, 14633893 - 14633834
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
14633893 |
taaaggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
14633834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 14772209 - 14772264
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14772209 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14772264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 15979338 - 15979393
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 20757403 - 20757454
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct |
20757454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 21553887 - 21553946
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
21553887 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctgta |
21553946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 26089730 - 26089785
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 28942524 - 28942575
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28942524 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 31480500 - 31480445
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 152 - 207
Target Start/End: Complemental strand, 34238918 - 34238863
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
34238918 |
aaaggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 35569138 - 35569079
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35569138 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35569079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 40169654 - 40169599
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
40169599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 45006247 - 45006192
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
45006192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 47005152 - 47005211
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
47005152 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgta |
47005211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 156 - 206
Target Start/End: Complemental strand, 3361817 - 3361767
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 203
Target Start/End: Original strand, 4814538 - 4814588
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4814538 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 15979702 - 15979644
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
15979702 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgta |
15979644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 25710509 - 25710567
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
25710509 |
aggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
25710567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 29446207 - 29446149
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
29446207 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgta |
29446149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 29490744 - 29490686
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
29490744 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgta |
29490686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 29525103 - 29525157
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
29525103 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 30552481 - 30552423
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
30552481 |
aaaggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 40545563 - 40545621
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
40545563 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgta |
40545621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 47005520 - 47005462
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
47005520 |
aggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgta |
47005462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 863660 - 863595
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
863660 |
aaaataaaggttaaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgta |
863595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 4035053 - 4034996
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgta |
4034996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 7957226 - 7957169
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgta |
7957169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 39072213 - 39072156
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgta |
39072156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 40277818 - 40277879
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
40277818 |
taaaggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgta |
40277879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 45313863 - 45313806
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgta |
45313806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 474409 - 474353
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
474409 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 4814900 - 4814845
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
4814900 |
aaggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccct |
4814845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 9596759 - 9596815
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgta |
9596815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 15286155 - 15286207
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 25610129 - 25610073
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccttgta |
25610073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 28452377 - 28452321
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
28452377 |
aggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 29678021 - 29678081
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29678021 |
aaaggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgta |
29678081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 46186410 - 46186466
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccttgta |
46186466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 150 - 206
Target Start/End: Original strand, 47114482 - 47114538
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
47114482 |
ataaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 49670803 - 49670747
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccc-tgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg |
49670747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 204
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
204 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 9863050 - 9863100
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccct |
9863100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 144 - 211
Target Start/End: Complemental strand, 20907468 - 20907401
Alignment:
| Q |
144 |
ataaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||| | ||| ||||||||||||||| |||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
20907468 |
ataaaaaaataggttaaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgt |
20907401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 150 - 197
Target Start/End: Original strand, 25353194 - 25353241
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25353194 |
ataaaggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 27681688 - 27681625
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||| | ||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27681688 |
aatataggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgta |
27681625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 31869596 - 31869651
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgta |
31869651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 43441270 - 43441325
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 7588317 - 7588375
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
7588317 |
aggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtctctgta |
7588375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 9603920 - 9603862
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
9603920 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttattctctgta |
9603862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 20644885 - 20644819
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| |||||| || ||||||| |||||||||||||| |
|
|
| T |
20644885 |
aaaaagaaaggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgta |
20644819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 30034473 - 30034415
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
30034473 |
aggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgta |
30034415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 30128283 - 30128341
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
30128283 |
aggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgta |
30128341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 207
Target Start/End: Complemental strand, 30130506 - 30130452
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
30130506 |
aaggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 38232232 - 38232298
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
38232232 |
aaaaattaaggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtccttgta |
38232298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 43440785 - 43440735
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 45161116 - 45161170
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgta |
45161170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 146 - 208
Target Start/End: Original strand, 47901791 - 47901853
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||| ||||| |||||||||||||||||| ||| |||||||| ||||||||||||||||||| |
|
|
| T |
47901791 |
aaaaagaaaggttaaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc |
47901853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 3387263 - 3387320
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3387263 |
aaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 4322197 - 4322132
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||| |||||||| ||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
4322197 |
aaaattaaggttaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgta |
4322132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 8510523 - 8510474
Alignment:
| Q |
161 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
8510474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 19844265 - 19844322
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgta |
19844322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 30424628 - 30424685
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||| ||||||||| ||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtctctgta |
30424685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 30426226 - 30426174
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 152 - 205
Target Start/End: Original strand, 35177252 - 35177305
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
35177252 |
aaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 52342194 - 52342243
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
52342194 |
aggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 8940157 - 8940217
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| |||||||||||||| || |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8940157 |
aaaggttaaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgta |
8940217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 10778367 - 10778427
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
10778367 |
aaaggttaaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctgta |
10778427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 148 - 212
Target Start/End: Original strand, 29686537 - 29686601
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||| ||||||||||| |||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
29686537 |
aaattaaggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgta |
29686601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 32119219 - 32119275
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
32119219 |
aggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 46622130 - 46622074
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
46622130 |
aggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 211
Target Start/End: Complemental strand, 47902145 - 47902089
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
47902145 |
ggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctgt |
47902089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 51500397 - 51500449
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||| ||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
51500397 |
aggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 146 - 202
Target Start/End: Original strand, 53113434 - 53113490
Alignment:
| Q |
146 |
aaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
53113434 |
aaaaaaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 150 - 205
Target Start/End: Complemental strand, 275838 - 275783
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||| |||||||||||| |||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
275838 |
ataatggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt |
275783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 2486900 - 2486845
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccttgta |
2486845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 14772523 - 14772468
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctgta |
14772468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 46901103 - 46901154
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
46901103 |
aggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 1721092 - 1721146
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||| |||||||||||||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgta |
1721146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 8555305 - 8555251
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccttgta |
8555251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 13514578 - 13514520
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
13514578 |
aggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtccatgta |
13514520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 18175791 - 18175846
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccctgta |
18175846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 20405224 - 20405166
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | | ||||| ||||||||||||||| |
|
|
| T |
20405224 |
aggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgta |
20405166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 20757776 - 20757718
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| ||||| |||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
20757776 |
aggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtctctgta |
20757718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 25609766 - 25609824
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
25609766 |
aggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgta |
25609824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 28452146 - 28452204
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| || |||||||||||||||| |||| |
|
|
| T |
28452146 |
aggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgta |
28452204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 35407791 - 35407733
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
35407791 |
aggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgta |
35407733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 35498415 - 35498473
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
35498415 |
aggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctgta |
35498473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 40545836 - 40545782
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgta |
40545782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc |
16679727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 20644505 - 20644562
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||| ||||| |||||||||||||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgta |
20644562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 40370285 - 40370342
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgta |
40370342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 50009284 - 50009227
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||| ||||||||| |||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgta |
50009227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 50261936 - 50261879
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
50261936 |
ggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtctctgta |
50261879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 53701361 - 53701418
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||| |||| ||||||||||||||| |
|
|
| T |
53701361 |
ggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgta |
53701418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 11463480 - 11463424
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtctctgta |
11463424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 205
Target Start/End: Complemental strand, 12673983 - 12673931
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||| ||||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
12673983 |
aaggttaaaatatgattttagttcctgcaaatatgcctcattttggttttagt |
12673931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 193
Target Start/End: Complemental strand, 26273826 - 26273786
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgt |
193 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26273826 |
aaggctaaaatatggttttagtcccagcaaatatgcctcgt |
26273786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 28418899 - 28418843
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | |||||| |||||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgta |
28418843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 206
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 152 - 187
Target Start/End: Complemental strand, 26800172 - 26800137
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
26800172 |
aaaggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 30034109 - 30034164
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||||||||||||||| ||| |||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgta |
30034164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 35936778 - 35936833
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc |
208 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| | |||||||||||||| |||| |
|
|
| T |
35936778 |
aaggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccc |
35936833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 45521838 - 45521779
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
45521838 |
aaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgta |
45521779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 863280 - 863338
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
863280 |
aggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgta |
863338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 29678387 - 29678333
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct |
29678333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 36672966 - 36673020
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
36672966 |
taaaatatggttttggtctctgcaaatatgtcttgttttggttttagtctctgta |
36673020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 39132907 - 39132849
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || | ||||||| |||||||||| |
|
|
| T |
39132907 |
aggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctgta |
39132849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 44506579 - 44506629
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
44506579 |
aaaggctaaaatatggttttagtccctgcaaatataacgagttttggtttt |
44506629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 51058593 - 51058647
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
51058593 |
taaaatatggttttagtctctgctaatatgcatcgttttgactttagtccctgta |
51058647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 54767524 - 54767470
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| |||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgta |
54767470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 20807800 - 20807849
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| | || ||||| ||||||||| |
|
|
| T |
20807800 |
taaaatatggttttagtccctgcaaatatacgtcattttgattttagtcc |
20807849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 210
Target Start/End: Complemental strand, 25610061 - 25610016
Alignment:
| Q |
165 |
tggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 212
Target Start/End: Original strand, 29490377 - 29490426
Alignment:
| Q |
163 |
tatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||| |||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
29490377 |
tatggttttggtccctacaaatatgcaccgttttggttttagtccctgta |
29490426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 34582522 - 34582579
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
34582522 |
aaggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
34582579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 205
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt |
36673195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 207
Target Start/End: Original strand, 53632498 - 53632555
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| ||||||| |||||||||| |
|
|
| T |
53632498 |
ataaaggataaaatatggttttagtccctataaatatggttcgttttagttttagtcc |
53632555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 184
Target Start/End: Complemental strand, 10792973 - 10792941
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10792973 |
aaaggctaaaatatggttttagtccctgcaaat |
10792941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 205
Target Start/End: Complemental strand, 16123491 - 16123452
Alignment:
| Q |
165 |
tggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16123491 |
tggttttagtcc-tgcaaatatgcctcgttttggttttagt |
16123452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 205
Target Start/End: Complemental strand, 21971060 - 21971000
Alignment:
| Q |
145 |
taaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||| |||||| | |||||||||||||| || || |||||||||||||||||| ||||||| |
|
|
| T |
21971060 |
taaagataaagaccaaaatatggttttaatctctacaaatatgcctcgttttgattttagt |
21971000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 205
Target Start/End: Complemental strand, 21993496 - 21993436
Alignment:
| Q |
145 |
taaaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||| |||||| | |||||||||||||| || || |||||||||||||||||| ||||||| |
|
|
| T |
21993496 |
taaagataaagaccaaaatatggttttaatctctacaaatatgcctcgttttgattttagt |
21993436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 199
Target Start/End: Complemental strand, 44802552 - 44802504
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggt |
199 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
44802552 |
taaaggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 49670477 - 49670529
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||| ||||||||| |||||||||| || |||||||||||| |||||| |
|
|
| T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctg |
49670529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 207
Target Start/End: Original strand, 590197 - 590228
Alignment:
| Q |
176 |
cctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
590197 |
cctgcaaatatgcctcgttttggttttagtcc |
590228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 20404889 - 20404940
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||||| |||||||||| |
|
|
| T |
20404889 |
aggctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagt |
20404940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 155 - 206
Target Start/End: Complemental strand, 29686870 - 29686819
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||| ||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
29686870 |
ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggttttagtc |
29686819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 30552150 - 30552200
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||| || |||||||||| || |||||||||||||||||| |
|
|
| T |
30552150 |
taaaatatggttttagacc-tgcaaatatgtcttgttttggttttagtccct |
30552200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 212
Target Start/End: Complemental strand, 33794788 - 33794749
Alignment:
| Q |
173 |
gtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33794788 |
gtccctgcaaatatgcctcgttttaattttagtccctgta |
33794749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 204
Target Start/End: Original strand, 35533281 - 35533328
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
204 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| || ||||||||||||| |
|
|
| T |
35533281 |
ctaaaatatggttttggtctctgcaaatatgtcttgttttggttttag |
35533328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 212
Target Start/End: Complemental strand, 38232594 - 38232543
Alignment:
| Q |
161 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| || |||||||||||| ||||||||||||| |||| ||||| |
|
|
| T |
38232594 |
aatatggttttggtacctgcaaatatgtctcgttttggtttcagtctctgta |
38232543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 186
Target Start/End: Original strand, 39819308 - 39819343
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39819308 |
taaagcctaaaatatggttttagtccctgcaaatat |
39819343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 212
Target Start/End: Original strand, 40560492 - 40560531
Alignment:
| Q |
173 |
gtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40560492 |
gtccctgcaaatatgcctcgttttaattttagtccctgta |
40560531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 52401009 - 52401072
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
52401009 |
aaaattaaggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccctg |
52401072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 3387338 - 3387380
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
3387338 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3387380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 4034790 - 4034832
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
4034790 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4034832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 4321945 - 4322003
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| | ||| |||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
4321945 |
aggctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctgta |
4322003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 7957154 - 7957112
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
7957154 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
7957112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 9262081 - 9262039
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
9262081 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9262039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 210
Target Start/End: Complemental strand, 10778706 - 10778676
Alignment:
| Q |
180 |
caaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10778706 |
caaatatgcctcgttttggttttagtccctg |
10778676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 35177563 - 35177509
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| || ||||||||||| |||||||| |
|
|
| T |
35177563 |
taaaatatggttttcatccttgcaaatatgcttccttttggttttaatccctgta |
35177509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 206
Target Start/End: Original strand, 35565581 - 35565619
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagtc |
35565619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 39132834 - 39132792
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
39132834 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
39132792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 205
Target Start/End: Complemental strand, 40279339 - 40279285
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| || |||||| ||||||| |
|
|
| T |
40279339 |
taaaggctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagt |
40279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 45005959 - 45006001
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
45005959 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
45006001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 52342509 - 52342467
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
52342509 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52342467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 52956627 - 52956585
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
52956627 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52956585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 186
Target Start/End: Complemental strand, 53122537 - 53122499
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
53122537 |
aaattaaggctaaaatatgcttttagtccctgcaaatat |
53122499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 28452303 - 28452262
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
28452303 |
ttttagtccctgcaaatatgtctcattttggttttggtccct |
28452262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 148 - 205
Target Start/End: Original strand, 36732633 - 36732690
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||| |||| ||||||| |||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
36732633 |
aaattaaggttaaaataaggttttggtccctgcaaatatgtcttattttggttttagt |
36732690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 40370515 - 40370474
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
40370515 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
40370474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 50008921 - 50008974
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
50008921 |
gctagaatatggttttggtccctgcaaatatgttttattttggttttagtccct |
50008974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 164 - 205
Target Start/End: Complemental strand, 52956691 - 52956650
Alignment:
| Q |
164 |
atggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
52956691 |
atggttttggtctctgcaaatatgcatcgttttggttttagt |
52956650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 53121300 - 53121357
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| | |||| |||||||||||||| |
|
|
| T |
53121300 |
aaggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
53121357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 16679969 - 16679905
Alignment:
| Q |
148 |
aaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| |||||||||| |||| ||| |||||||||||| || ||| ||||| ||||| |||||||| |
|
|
| T |
16679969 |
aaattaaggctaaaagatggctttggtccctgcaaatttgtctcattttgattttaatccctgta |
16679905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 210
Target Start/End: Original strand, 20644584 - 20644620
Alignment:
| Q |
174 |
tccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
20644584 |
tccctgcaaatatgtctcgttttggttttggtccctg |
20644620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 20907158 - 20907194
Alignment:
| Q |
176 |
cctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
20907158 |
cctgtaaatatgtctcgttttggttttagtccctgta |
20907194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 205
Target Start/End: Original strand, 27200436 - 27200488
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||| ||| |||| |||||||| |
|
|
| T |
27200436 |
aaggttaaaatatggttttaatccctgcaaatatatctcattttagttttagt |
27200488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 205
Target Start/End: Original strand, 39071860 - 39071912
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||| ||||||| |||||||| |
|
|
| T |
39071860 |
aaggctaaaatatatttttagtccttacaaatatgcttcgttttagttttagt |
39071912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 186
Target Start/End: Complemental strand, 39820664 - 39820632
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
39820664 |
aggctaaaatatggttttggtccctgcaaatat |
39820632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 46724901 - 46724845
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||| || ||||||||||| | |||||| |||||||||||||| |
|
|
| T |
46724901 |
gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgta |
46724845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 186
Target Start/End: Complemental strand, 47433869 - 47433837
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
47433869 |
aggctaaaatatggttttggtccctgcaaatat |
47433837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 52403184 - 52403128
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
52403184 |
aggctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtccctg |
52403128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 2776 - 2835
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2776 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
2835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 366275 - 366216
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
366275 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
366216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 365979 - 366036
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgta |
366036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 9028 - 8971
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
8971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 8734 - 8789
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
8789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 14696 - 14753
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14696 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 15013 - 14955
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgta |
14955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 3922 - 3861
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3922 |
taaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgta |
3861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 3532 - 3589
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
3589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 5206 - 5266
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5206 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgta |
5266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 5226 - 5286
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5226 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgta |
5286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 57; Significance: 5e-24; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 54812 - 54872
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54812 |
aaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
54872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 1308 - 1366
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1308 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 150 - 210
Target Start/End: Complemental strand, 1649 - 1589
Alignment:
| Q |
150 |
ataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1649 |
ataaaggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg |
1589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 82707 - 82649
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
82707 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
82649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 82339 - 82396
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
82339 |
aaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 8545 - 8602
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8545 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
8602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 291 - 234
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
291 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 12182 - 12239
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgta |
12239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 12536 - 12479
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgta |
12479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 54; Significance: 3e-22; HSPs: 5)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 149 - 210
Target Start/End: Original strand, 47919 - 47980
Alignment:
| Q |
149 |
aataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47919 |
aataaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 48228 - 48174
Alignment:
| Q |
158 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgta |
48174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 223173 - 223120
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
223173 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 222817 - 222870
Alignment:
| Q |
159 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||| ||||||||||| ||||||| || |||||||||||||| |||||| |
|
|
| T |
222817 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctgta |
222870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #5
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 222884 - 222925
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
222884 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
222925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 75765 - 75709
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75765 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 75358 - 75416
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
75358 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgta |
75416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 34931 - 34986
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
34986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 151 - 206
Target Start/End: Original strand, 5395 - 5450
Alignment:
| Q |
151 |
taaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5395 |
taaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 5710 - 5653
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
5710 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
5653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 3292 - 3234
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3292 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgta |
3234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 27365 - 27307
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27365 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
27307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 27072 - 27114
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
27114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 18044 - 17986
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
18044 |
aggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgta |
17986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 94056 - 94114
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
94056 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgta |
94114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 156 - 203
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 4312 - 4255
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgta |
4255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 162 - 210
Target Start/End: Original strand, 4016 - 4064
Alignment:
| Q |
162 |
atatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 12525 - 12582
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgta |
12582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 50; Significance: 8e-20; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 4040 - 4093
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4040 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
4093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 19222 - 19275
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19222 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 147 - 207
Target Start/End: Complemental strand, 4296 - 4236
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
4296 |
aaaacaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
4236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 147 - 207
Target Start/End: Complemental strand, 19478 - 19418
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
19478 |
aaaacaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
19418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 24371 - 24428
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24371 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 24657 - 24601
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||||||||| |||||||||||||| |
|
|
| T |
24657 |
ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccctgta |
24601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 17966 - 17909
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgta |
17909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 17651 - 17707
Alignment:
| Q |
156 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| || ||||| ||||||||||||||| |
|
|
| T |
17651 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgta |
17707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 148282 - 148225
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
148225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 152 - 209
Target Start/End: Original strand, 147887 - 147941
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||| |||||||||||| |
|
|
| T |
147887 |
aaaggctaaaatatggtttt-gtccctgcaaatat--ctcgttttagttttagtccct |
147941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 8327 - 8387
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
8327 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgta |
8387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 8645 - 8585
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
8645 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgta |
8585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 155 - 207
Target Start/End: Original strand, 10168 - 10220
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 10516 - 10458
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
10516 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgta |
10458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 2661 - 2606
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2661 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 2333 - 2382
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
2333 |
aggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 44; Significance: 3e-16; HSPs: 3)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 22057 - 21998
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| |||||||||||||||||||||| |||| |
|
|
| T |
22057 |
aaggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttgta |
21998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 21763 - 21804
Alignment:
| Q |
168 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
21763 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
21804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 187
Target Start/End: Original strand, 21688 - 21728
Alignment:
| Q |
147 |
aaaataaaggctaaaatatggttttagtccctgcaaatatg |
187 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
21688 |
aaaaaaaaggctaaaatatggttttgatccctgcaaatatg |
21728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 3751 - 3809
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | |||||||||||| |||||||| |
|
|
| T |
3751 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgta |
3809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 4080 - 4028
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
206 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
4080 |
aggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 16724 - 16781
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgta |
16781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 2500 - 2555
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
2500 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 2883 - 2829
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 205
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 35085 - 35027
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||| |||||||||||||||||||||||| |
|
|
| T |
35085 |
aggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgta |
35027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 37; Significance: 0.000000000005; HSPs: 3)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 189681 - 189621
Alignment:
| Q |
152 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
212 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
189681 |
aaaggctaaaatatagtttttgtcgctgcaaatatgcctcattttggttttaatctctgta |
189621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 61630 - 61687
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
210 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| |||||| |||||||||||| |
|
|
| T |
61630 |
aaggctaaaatatggtattggtccctgcaaatatgcacagttttgattttagtccctg |
61687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 189328 - 189379
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||||||||||| ||||| | |||| ||||||||||||||||||||||||| |
|
|
| T |
189328 |
aggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagt |
189379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 205
Target Start/End: Complemental strand, 5072 - 5020
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
5072 |
aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
155 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| || ||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 7266 - 7216
Alignment:
| Q |
153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
203 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||||| || |||||||||||| |
|
|
| T |
7266 |
aaggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta |
7216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 17126 - 17174
Alignment:
| Q |
157 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
205 |
Q |
| |
|
||||||||||||||| |||||| |||||||| | |||||||||||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagt |
17174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 186
Target Start/End: Complemental strand, 30967 - 30935
Alignment:
| Q |
154 |
aggctaaaatatggttttagtccctgcaaatat |
186 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
30967 |
aggctaaaatatggttttggtccctgcaaatat |
30935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University