View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12176_low_1 (Length: 341)

Name: NF12176_low_1
Description: NF12176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12176_low_1
NF12176_low_1
[»] chr8 (1 HSPs)
chr8 (131-323)||(2517584-2517776)


Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 131 - 323
Target Start/End: Original strand, 2517584 - 2517776
Alignment:
131 gatgggaaaattatataaaagcaatgaactttcagttcctaataagtacatgactcattcaatattggttcttttccaaaccaaagcaggctgaacaaaa 230  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2517584 gatgggaagattatataaaagcaatgaactttcagttcctaataagtacatgactcattcaatattggttcttttccaaaccaaagcaggctgaacaaaa 2517683  T
231 gaagaaaacggaaaaagaatgtaggaccaaacagccagcagatactaaacaaagaaaggagtcatttagcacatgaaaacatcataacttaag 323  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2517684 gaagaaaacggaaaaagaatgtaggaccaaacagccagcagatactaaacaaagaaaggagtcatttagcacatgaaaacatcataacttaag 2517776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University