View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12178_high_6 (Length: 222)
Name: NF12178_high_6
Description: NF12178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12178_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 17 - 205
Target Start/End: Original strand, 1378065 - 1378255
Alignment:
| Q |
17 |
actaacattaattaattatattattctggatcttcaaatctagatatggactgcatgcacccaatgcactcttcaatcatatcctatagtttatttaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1378065 |
actaacattaattaattatattattctggatcttcaaatctagatatggactgcatgcacccaatgcactcttcaatcatatcctatagtttatttaaaa |
1378164 |
T |
|
| Q |
117 |
gaatcacaacctc--gtgttgtgttcttaatcagtccaataatgagatgataagtactgttattaattctccataaaatggtaggcagaac |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1378165 |
gaatcacaacctcatgtgttgtgttcttaatcagtccaataatgagatgataactactgttattaattctccataaaatggtaggcagaac |
1378255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University