View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12178_low_10 (Length: 229)
Name: NF12178_low_10
Description: NF12178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12178_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 44 - 213
Target Start/End: Complemental strand, 29382154 - 29381981
Alignment:
| Q |
44 |
gctgatatatacacctacgttacgtgtaaggagtttttattttaa----ggtaaaataaaataaaatttatcattggttatcggataaacaattgaaata |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29382154 |
gctgatatatacacctacgttacgtgtaaggagtttttattttaattaaggtaaaataaaataaaatttatcattggttatcggataaacaattgaaata |
29382055 |
T |
 |
| Q |
140 |
agatgcttttacttgttaatttggtttggataattaaagaatgggtttggcgtgtgatttgattaagtgtgtat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29382054 |
agatgcttttacttgttaatttggtttggataattaaagaatgggtttggcgtgtgatttgattaagtgtgtat |
29381981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University