View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12178_low_9 (Length: 229)
Name: NF12178_low_9
Description: NF12178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12178_low_9 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 229
Target Start/End: Complemental strand, 27025271 - 27025048
Alignment:
| Q |
6 |
attaggtacacaacaatctcaatatgtatgtctagtattaggtacataataatctcaattttggatatatacttcttgatgtatattgttaaaattgttg |
105 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27025271 |
attaggtacacagcaatctcaatatgtatgtctagtattaggtacataataatctcaattttggatatatacttcttgatgtatattgttaaaattgttg |
27025172 |
T |
|
| Q |
106 |
aattctggagacatgctttcaaaatttagttaagtttaactagaactaaactcgtagaagctactaaaaccttcgtaaaaaagtaaattttatttaaaca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27025171 |
aattctggagacatgctttcaaaatttagttaagtttaactagaactaaactcgtagaagctactaaaaccttcgtaaaaaagtaaattttatttaaaca |
27025072 |
T |
|
| Q |
206 |
ttttctgtttttaaagtgattgta |
229 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27025071 |
ttttctgtttttaaagtgattgta |
27025048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University