View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12179_high_6 (Length: 242)
Name: NF12179_high_6
Description: NF12179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12179_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 3 - 162
Target Start/End: Complemental strand, 53498086 - 53497929
Alignment:
| Q |
3 |
aataatatcttagttagtggatggataaggtcacggtcaccgtcgtcacctttgaataatacttggaccctatcccccctggcaagaggcaccagctagc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53498086 |
aataatatcttagttagtggatggataaggtcacggtcaccgtcgtcacctttgaataatacctggaccctatcccc--tggcaagaggcaccagctagc |
53497989 |
T |
 |
| Q |
103 |
tgtaaaattttgctttttcacttgttagaagagtatatccaaatgcttctggattgatac |
162 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53497988 |
tgtaaaattttactttttcacctgttagaagagtatatccaaatgcttctggattgatac |
53497929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 161 - 223
Target Start/End: Complemental strand, 53497898 - 53497834
Alignment:
| Q |
161 |
acaaaaattgaaacatagtttggaaattcgaactttgtt--ttttattgaaaatcatggatttgt |
223 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53497898 |
acaaaaattgacacatagtttggaaattcgaactttgttttttttattgaaaatcatggatttgt |
53497834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University