View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12179_low_7 (Length: 365)
Name: NF12179_low_7
Description: NF12179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12179_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 12 - 347
Target Start/End: Complemental strand, 13234336 - 13234001
Alignment:
| Q |
12 |
acagacacactgtgaaaatgaagaaactgagacgatttgtgattccttgtaaggtattttttggattgtggaacattgttgccatcataactcccatgaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13234336 |
acagacacactgtgaaaatgaagaaactgagacgatttgtgattccttgtaaggtattttttggattgtggaacattgttgccatcataactcccatgaa |
13234237 |
T |
|
| Q |
112 |
ggtgaggaccattagtcttgatagaaaaagctcgggggttctccgtatgttggtgaagttgcggcgcattaggatccatgtctctgctatgtaggaattt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13234236 |
ggtgaggaccattagtcttgatagaaaaagctcgggggttctccgtatgtttgtgaagttgcggcgcattaggatccatgtctctcctatgtaggaattt |
13234137 |
T |
|
| Q |
212 |
gcaaactttggacctagatgttcttgtgagctattggttggtgtaaggtagtcattctcgtcgactacgtagtcgctgctatgtggtgttggtgttgctg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13234136 |
gcaaactttggacctagatgttcttgtgagctatttgttggtgtaaggtagtcattctcgtcgactacgtagtcactgctatgtggtgttggtgttgctg |
13234037 |
T |
|
| Q |
312 |
gaaggatttcacttgagtatgtgtagatgccagggg |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
13234036 |
gaaggatttcacttgagtatgtgtagatgccagggg |
13234001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University