View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12180_low_11 (Length: 365)
Name: NF12180_low_11
Description: NF12180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12180_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 9 - 192
Target Start/End: Original strand, 3904513 - 3904696
Alignment:
| Q |
9 |
agcagagagagttggtaggctccaaagaggagatgatagaggtattagggggttagctatagttggagtagccttgctgctagctctaccaaggggcgaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3904513 |
agcagagagagttggtaggctccaaagaggagatgatagaggtattagggggttagctatagttggagtagccttgctgctagctctaccaagaggcgaa |
3904612 |
T |
|
| Q |
109 |
gagatacctttaccttgaagtacactttgcttaactgtcgaatcagatgttctagcagctgcagatatcaattataaagagttt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3904613 |
gagatacctttaccttgaagtacactttgcttaactgtcgaatcagatgttctagcagctgcagatatcaattataaagagttt |
3904696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 256 - 356
Target Start/End: Original strand, 3904760 - 3904860
Alignment:
| Q |
256 |
taccagatcttgactgcagaggtgtttctggggtattaggatgagatttttgactacgctgcctttccatgcagacacgccagacattctcccacaggtt |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3904760 |
taccagatcttgactgcagaggtgtttctggggtattaggatgagatttttgactacgctgcctttccatgcagacacgccagacattctcccacaggtt |
3904859 |
T |
|
| Q |
356 |
c |
356 |
Q |
| |
|
| |
|
|
| T |
3904860 |
c |
3904860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University