View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12181_low_8 (Length: 227)
Name: NF12181_low_8
Description: NF12181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12181_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 15 - 208
Target Start/End: Original strand, 30402950 - 30403143
Alignment:
| Q |
15 |
cagagatgcatgcacatctgcataaaataacttcgaaagcaaaaaatttatagcatacatattttcaatcatgggacacctacccccctttgcaactcgg |
114 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||| || |
|
|
| T |
30402950 |
cagagatgcacgcgcatctgcataaaataacttcaaaagcaaaaaatttatagcgtacatattttcaatcatgggacacctacccccttttctaacttgg |
30403049 |
T |
|
| Q |
115 |
caaaatatttgtcttgtatctcaaactcttcaaatgttttctcatttagtagcacatgctttaagattaagcatgttgagtttcatctcgtttg |
208 |
Q |
| |
|
||| |||||| ||||||||||| | ||||||||||||||||| ||||| ||||||| | |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
30403050 |
caacatatttatcttgtatctctagctcttcaaatgttttcttatttattagcacagggtttaagattaagtatgttgagtttcatctcatttg |
30403143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University