View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12182_high_12 (Length: 341)
Name: NF12182_high_12
Description: NF12182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12182_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 14 - 326
Target Start/End: Complemental strand, 51804188 - 51803876
Alignment:
| Q |
14 |
acattgttaagttgtattgttgcttctcaagtttggattgtagcttgttggtttatgagtatatgccaaatggtactttgtatgattctcttcataaggg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51804188 |
acattgttaagttgtattgttgcttctcaagtttggattgtagcttgttggtttatgagtatatgccaaatggtactttgtatgattctcttcacaaggg |
51804089 |
T |
|
| Q |
114 |
ttggattcatttggattggcctacaaggtataggattgcacttggaattgctcagggtgttgcataccttcaccatgatttggtttttcctattatccat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804088 |
ttggattcatttggattggcctacaaggtataggattgcacttggaattgctcagggtgttgcataccttcaccatgatttggtttttcctattatccat |
51803989 |
T |
|
| Q |
214 |
agagatattaagtcaacaaatattctcttggatgaagattaccatcctaaggttgcagattttgggattgctaaggttttgcaggcaagaggagcaaagg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51803988 |
agagatattaagtcaacaaatattctcttggatgaagattaccatcctaaggttgcagattttgggattgctaaggttttgcaggcaagaggagcaaagg |
51803889 |
T |
|
| Q |
314 |
attccacaaccac |
326 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51803888 |
attccacaaccac |
51803876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 30 - 197
Target Start/End: Complemental strand, 36578673 - 36578512
Alignment:
| Q |
30 |
ttgttgcttctcaagtttggattgtagcttgttggttt----atgagtatatgccaaatggtactttgtatgattctcttcataagggttggattcattt |
125 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||| ||||| ||| | || |
|
|
| T |
36578673 |
ttgttgcttctcaattttggattgtagcttgttggtttgtttatgagtacatgccaaatggtactttatatgattcacttcacaag----------agtt |
36578584 |
T |
|
| Q |
126 |
ggattggcctacaaggtataggattgcacttggaattgctcagggtgttgcataccttcaccatgatttggt |
197 |
Q |
| |
|
|||| | ||||| | |||||| || | ||||||||||| | ||||| ||||||||||||||||||||||||| |
|
|
| T |
36578583 |
ggatcgacctactaagtatagaatcgaacttggaattgattagggtcttgcataccttcaccatgatttggt |
36578512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University