View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12182_high_19 (Length: 263)
Name: NF12182_high_19
Description: NF12182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12182_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 20 - 253
Target Start/End: Original strand, 7752477 - 7752710
Alignment:
| Q |
20 |
aaaatgtcctacttgggattaaatctcaattcaacaatgcctcagtcttcacaacctgggatcctatcactgactgctgtaaaaattggtcaggcataga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752477 |
aaaatgtcctacttgggattaaatctcaattcaacaatgcctcagtcttcacaacatgggatcctatcactgactgctgtaaaaattggtcaggcataga |
7752576 |
T |
 |
| Q |
120 |
atgcaattcaaatggccgtgtgaccatgcttgcagttagtgacaccaatgacgtcgttggcgagatcccaacatcggtagtaaaccttccgttcctccaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7752577 |
atgcaattcaaatggccgtgtgaccatgcttgcagttagtgacaccaatgacgtcattggcgagatcccaacctcggtagtaaaccttccgttcctccaa |
7752676 |
T |
 |
| Q |
220 |
tttttcacattcgctgtctttcccggtgtctctg |
253 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| |
|
|
| T |
7752677 |
ttttttacatttgctgtctttcccggtgtctctg |
7752710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University