View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12182_low_10 (Length: 403)
Name: NF12182_low_10
Description: NF12182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12182_low_10 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 221 - 403
Target Start/End: Original strand, 33871005 - 33871187
Alignment:
| Q |
221 |
aatataggttgctttcgatcagagacgtagcagtcgtggttcaacatggtactccttttatgttctcggactcgcaggattctgtttccaagatgaagtc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33871005 |
aatataggttgctttcgatcagagacgtagcagttgtggttcaacatggtactccttttatgttctcggactcgcaggattctgtttccaagatgaagtc |
33871104 |
T |
 |
| Q |
321 |
ttttctatccaacggtgactccactgttagtcatactttttcatgctttgtattttcgccttgtttggataaacaacttaatt |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33871105 |
ttttctatccaacggtgactccactgttagtcatactttttcatgctttgtattttcgccttgtttggataaacaacttaatt |
33871187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 18 - 156
Target Start/End: Original strand, 33870802 - 33870940
Alignment:
| Q |
18 |
tcacacatctcctccgccggctacacttccccctccgacgctttctctcccaccgtagaattgtcgcaggctgaagtcagtgcttgcttgtctttcgctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33870802 |
tcacacatctcctccgccggctacacttccccctccgatgctttctctcccaccgtagaattgtcgcaggctgaagtcagtgcttgcttgtctttcgctc |
33870901 |
T |
 |
| Q |
118 |
gagatagacctaaccttctcaggtttgtttctgtttcca |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33870902 |
gagatagacctaaccttctcaggtttgtttctgtttcca |
33870940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University