View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12182_low_20 (Length: 284)
Name: NF12182_low_20
Description: NF12182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12182_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 19 - 268
Target Start/End: Original strand, 1056509 - 1056758
Alignment:
| Q |
19 |
aaacaaaaaccccactctttttaagtttcaaccacctttcccattactcataaatcctcaattctcagatctacaatctctctttctccgatggcttcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1056509 |
aaacaaaaaccccactctttttaagtttcaaccacctttcccattactcataaatcctcaattctcagatctacaatctctctttctccgatggcttcta |
1056608 |
T |
|
| Q |
119 |
cggctgttgcaaccgccgaatcgccgcaacatcccgttcaaccttcttcttcttcctccgttgttgatcgtaaccattcttccaattcttcccctaactt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1056609 |
cggctgttgcaaccgccgaatcgccgcaacatcccgttcaaccttctccttcttcctccgttgttgatcgtaaccattcttccaattcttcccctaactt |
1056708 |
T |
|
| Q |
219 |
tttcaattcttccgatattccggtacgtttttcttcttacattcgtcaca |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1056709 |
tttcaattcttccgatattccggtacgtttttcttcttacattcgtcaca |
1056758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University