View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12182_low_24 (Length: 237)
Name: NF12182_low_24
Description: NF12182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12182_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 7e-39; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 87 - 172
Target Start/End: Original strand, 4203006 - 4203091
Alignment:
| Q |
87 |
atgtagctacaataacacgatgagttgttatcttcaatcttctcaattgttgttgttgtttggttgcatgtgccaccatccaattc |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4203006 |
atgtagctacaataacacgatgagttgttatcttcaatcttctcaattgctgttgttgtttggttgcatgtgccaccatccaattc |
4203091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 55
Target Start/End: Original strand, 4202939 - 4202974
Alignment:
| Q |
20 |
aattggtggtgagtgggagagcgtggaattttggga |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4202939 |
aattggtggtgagtgggagagcgtggaattttggga |
4202974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 218
Target Start/End: Original strand, 4203097 - 4203125
Alignment:
| Q |
190 |
catcatcatcactttctcttgcttttttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4203097 |
catcatcatcactttctcttgcttttttc |
4203125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University