View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12183_high_3 (Length: 235)
Name: NF12183_high_3
Description: NF12183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12183_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 44371133 - 44370900
Alignment:
| Q |
1 |
acggtggtcacaattgttgctgctgtataatcaacatgtatttatcctcttgattgaaatcaaatttgattgtacagataattagaactggaattgaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44371133 |
acggtggtcacaattgttgctgctgtataatcaacatgtatttatcctcttgattgaaatcaaatttgattgtacagataattagaactggaattgaaat |
44371034 |
T |
 |
| Q |
101 |
aatttacttcaactgaagtaatttacttccccagt------------agtcacaatcagtttttgagctcggatagtttatattatttcatatggctaaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44371033 |
aatttacttcaactgaagtaatttacttccccagtcacaaatgttgcagtcacaatcaatttttgagctcggatagtttatattatttcatatggctaaa |
44370934 |
T |
 |
| Q |
189 |
aatatatttgtttggtaattattttttcctcaca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44370933 |
aatatatttgtttggtaattattttttcctcaca |
44370900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University