View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12183_high_5 (Length: 205)
Name: NF12183_high_5
Description: NF12183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12183_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 12683749 - 12683569
Alignment:
| Q |
19 |
acctagagcctcattcaatgattaattacaatcattattttcattgaggtggcggtggtttgttggcaaccacttcataattgtcaataccttcgtcttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683749 |
acctagagcctcattcaatgattaattacaatcattattttcattgaggtggcggtggtttgttggcaaccacttcataattgtcaataccttcgtcttc |
12683650 |
T |
|
| Q |
119 |
gtcctcgtcatcatcaccgtcatcatcgtcataatattcttcttcatctcgacgcggctgatcattctcagtctctgcttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
12683649 |
gtcctcgtcatcatcaccgtcatcatcgtcataatattcttcttcatctcgatgcggccgatcattctcagtctcagcttc |
12683569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University