View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12183_high_6 (Length: 202)
Name: NF12183_high_6
Description: NF12183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12183_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 8e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 8e-63
Query Start/End: Original strand, 11 - 158
Target Start/End: Complemental strand, 29306640 - 29306496
Alignment:
| Q |
11 |
gagaagcagagattcagagatcaaaacagcaactgtgatcgcagttgcgttgtaagcctttatattgcggcaaaatgcagacaaatatggccgatgagcc |
110 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29306640 |
gagatgcagagattctgagatcaaaacagcaactgtgatcgcagttgcgttgtaagcctttatattgcggcaaaatgcagacaaatatggccgatgagcc |
29306541 |
T |
 |
| Q |
111 |
acatttacgccggctggaatactaatgtgaagaactctaaatttttta |
158 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29306540 |
acattta---cggctgcaatactaatgtgaagaactctaaatttttta |
29306496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University