View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12183_low_7 (Length: 214)
Name: NF12183_low_7
Description: NF12183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12183_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 20 - 145
Target Start/End: Original strand, 44086839 - 44086952
Alignment:
| Q |
20 |
gcccttctctttctcaaacacctttaagcattttcgatttcacctttaagcgacaaggatggagggtgagataagaaatcccaggataactcgaattcta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||| | | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44086839 |
gcccttctctttctcaaacacctttaagcattttctatttcagcttt------------tcaatggtgagataagaaatcccaggataactcgaattcta |
44086926 |
T |
 |
| Q |
120 |
gttgggttgtgaaaagcagaaaacat |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44086927 |
gttgggttgtgaaaagcagaaaacat |
44086952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 44086946 - 44086985
Alignment:
| Q |
162 |
aaaacattcagcatttactgtagtcttctattttcatctc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44086946 |
aaaacattcagcatttactgtagtcttctattttcatctc |
44086985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University