View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12183_low_8 (Length: 205)

Name: NF12183_low_8
Description: NF12183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12183_low_8
NF12183_low_8
[»] chr6 (1 HSPs)
chr6 (19-199)||(12683569-12683749)


Alignment Details
Target: chr6 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 12683749 - 12683569
Alignment:
19 acctagagcctcattcaatgattaattacaatcattattttcattgaggtggcggtggtttgttggcaaccacttcataattgtcaataccttcgtcttc 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12683749 acctagagcctcattcaatgattaattacaatcattattttcattgaggtggcggtggtttgttggcaaccacttcataattgtcaataccttcgtcttc 12683650  T
119 gtcctcgtcatcatcaccgtcatcatcgtcataatattcttcttcatctcgacgcggctgatcattctcagtctctgcttc 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||||    
12683649 gtcctcgtcatcatcaccgtcatcatcgtcataatattcttcttcatctcgatgcggccgatcattctcagtctcagcttc 12683569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University