View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12183_low_9 (Length: 202)

Name: NF12183_low_9
Description: NF12183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12183_low_9
NF12183_low_9
[»] chr5 (1 HSPs)
chr5 (11-158)||(29306496-29306640)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 8e-63; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 8e-63
Query Start/End: Original strand, 11 - 158
Target Start/End: Complemental strand, 29306640 - 29306496
Alignment:
11 gagaagcagagattcagagatcaaaacagcaactgtgatcgcagttgcgttgtaagcctttatattgcggcaaaatgcagacaaatatggccgatgagcc 110  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29306640 gagatgcagagattctgagatcaaaacagcaactgtgatcgcagttgcgttgtaagcctttatattgcggcaaaatgcagacaaatatggccgatgagcc 29306541  T
111 acatttacgccggctggaatactaatgtgaagaactctaaatttttta 158  Q
    |||||||   |||||| |||||||||||||||||||||||||||||||    
29306540 acattta---cggctgcaatactaatgtgaagaactctaaatttttta 29306496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University