View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12185_low_5 (Length: 298)
Name: NF12185_low_5
Description: NF12185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12185_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 274
Target Start/End: Original strand, 527917 - 528172
Alignment:
| Q |
19 |
cctctaacgctggggaaatgtcacatgaggagcagcagctaagactggagaatgctctccttaggaaagaggtacctcatcatttattacgattttcaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
527917 |
cctctaacgctggggaaatgtcacatgaggagcagcagctaagactggagaatgctctccttaggaaagaggtacctcatcatttattacgattttcaaa |
528016 |
T |
|
| Q |
119 |
atagatatgccctgcaaaaaatttaaaataatgatccaacatttatgattaacttttatcgtgtaagtacattaaattaaatcatccttaattattcgct |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528017 |
atagatatgccctgcaaaaaattaaaaataatgatccaacatttatgattaacttttaccgtgtaagtacattaaattaaatcatccttaattattcgct |
528116 |
T |
|
| Q |
219 |
aacaacatctttcatattgtttgatctcaaactaagctttagtttttcttttatgt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528117 |
aacaacatctttcatattgtttgatctcaaactaagctttagtttttcttttatgt |
528172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University