View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12185_low_8 (Length: 259)
Name: NF12185_low_8
Description: NF12185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12185_low_8 |
 |  |
|
| [»] scaffold0627 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 22)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 63 - 210
Target Start/End: Complemental strand, 31742789 - 31742642
Alignment:
| Q |
63 |
tgtaaaaacggaaaaatggtatctatatctttttgtcacagcctttttctcgataacttaccttttttaaaaccttgatcatttctctatccgttactct |
162 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
31742789 |
tgtaaaaacgaaaaaatggtatccatatctttttgtcgcagcctttttctcggtaacttaccttttttaaaaccttgatcatttctcattcctttactct |
31742690 |
T |
 |
| Q |
163 |
tccacctcaactaccaaaccaatcttatatctcctaaggtactaacat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31742689 |
tccacctcaactaccaaaccaatcttatatctcctaaggtactaacat |
31742642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 41617985 - 41618029
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
41617985 |
tccactggtgagagacttaattggaccctcactctagaatccacc |
41618029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 46491692 - 46491739
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacctgt |
65 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
46491692 |
tccaccggtgagggacttagttgaaccctcaccctagaatccacctgt |
46491739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 30581272 - 30581314
Alignment:
| Q |
20 |
cactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
30581272 |
cactggtgagggacttaattgaaccctcaccctagaattcacc |
30581314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 63
Target Start/End: Original strand, 34809005 - 34809038
Alignment:
| Q |
30 |
ggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34809005 |
ggacttaattgaaccctcactctagaatccacct |
34809038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 41358975 - 41359020
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||||||| |
|
|
| T |
41358975 |
tccactggtgatggacttaattgatccctcaccctagaatccacct |
41359020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 767180 - 767136
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
767180 |
tccaccggtgagggacttaattggaccctcaccctagaatccacc |
767136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 17114181 - 17114145
Alignment:
| Q |
26 |
tgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17114181 |
tgagggacttaattgaaccctcaccctagaatccacc |
17114145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 41617236 - 41617192
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| |||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
41617236 |
tccaccggtgagggacttaattgatcactcactctagaatccacc |
41617192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 41965781 - 41965825
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
41965781 |
tccaccggtgagggacttaattggaccctcaccctagaatccacc |
41965825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 42818557 - 42818601
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
42818557 |
tccaccggtgagggacttaattgaaccctcaccctagaattcacc |
42818601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 71
Target Start/End: Complemental strand, 3314993 - 3314946
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacctgtaaaaac |
71 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| | |||||| |
|
|
| T |
3314993 |
ggtgagggacttaattgaaccctcaccgtagaatccacccgcaaaaac |
3314946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 65
Target Start/End: Complemental strand, 41965148 - 41965109
Alignment:
| Q |
26 |
tgagggacttaattgaaccctcactctagaatccacctgt |
65 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
41965148 |
tgagggacttaattggaccctcaccctagaatccacctgt |
41965109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 24873795 - 24873750
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||||| |||||||| |||||| |||||||| ||||||||||||| |
|
|
| T |
24873795 |
tccactgatgagggacctaattggaccctcaccctagaatccacct |
24873750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 24874590 - 24874627
Alignment:
| Q |
26 |
tgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
24874590 |
tgagggacctaattgaaccctcaccctagaatccacct |
24874627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 28007201 - 28007156
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||| ||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
28007201 |
tccaccggtgagggacttaattgctccctcaccctagaatccacct |
28007156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 36611589 - 36611556
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaat |
57 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
36611589 |
ggtgagggacttaattgaaccctcaccctagaat |
36611556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 767970 - 768014
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| ||| |||||||| |
|
|
| T |
767970 |
tccaccggtgagggacttaattggaccctcaccctaaaatccacc |
768014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 56
Target Start/End: Original strand, 7329070 - 7329110
Alignment:
| Q |
16 |
gttccactggtgagggacttaattgaaccctcactctagaa |
56 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
7329070 |
gttccaccagtgagggacttaattgaaccctcaccctagaa |
7329110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 36611498 - 36611542
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| |||||| || |||||||||||||||| |||||||||||| |
|
|
| T |
36611498 |
tccaccggtgagagatttaattgaaccctcaccctagaatccacc |
36611542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 60
Target Start/End: Original strand, 44876944 - 44876980
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatcca |
60 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
44876944 |
ggtgagggacttaattgatccctcaccctagaatcca |
44876980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 63
Target Start/End: Complemental strand, 46491049 - 46491009
Alignment:
| Q |
23 |
tggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
46491049 |
tggtgatggacttaattgaaccctcaccctacaatccacct |
46491009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 11)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 27746162 - 27746206
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27746162 |
tccactggtgagggacttaattgaaccctcacgctagaatccacc |
27746206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 26240875 - 26240920
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26240875 |
tccaccggtgagggacttaattgaaccctcaccctagaatccacct |
26240920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 16449593 - 16449555
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16449593 |
ggtgagggacttaattgaaccctcaccctagaatccacc |
16449555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 16459167 - 16459129
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16459167 |
ggtgagggacttaattgaaccctcaccctagaatccacc |
16459129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 24848436 - 24848475
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
24848436 |
ggtgagggacttaatagaaccctcaccctagaatccacct |
24848475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 26240152 - 26240113
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
26240152 |
ggtgagggacttaattgatccctcaccctagaatccacct |
26240113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 27745594 - 27745555
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27745594 |
ggtgagggacttaattgaaccctcaccttagaatccacct |
27745555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 24847821 - 24847783
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
24847821 |
ggtgagggacttaatagaaccctcaccctagaatccacc |
24847783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 13 - 62
Target Start/End: Original strand, 12449311 - 12449360
Alignment:
| Q |
13 |
tgtgttccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||| ||||| |||||||||||||||||| ||||||| ||| |||||||| |
|
|
| T |
12449311 |
tgtggtccaccggtgagggacttaattgatccctcaccctaaaatccacc |
12449360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 31109283 - 31109239
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| |||||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
31109283 |
tccaccggtgagggacctaattggaccctcaccctagaatccacc |
31109239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 31116688 - 31116732
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| |||||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
31116688 |
tccaccggtgagggacctaattggaccctcaccctagaatccacc |
31116732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 12)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 29595600 - 29595642
Alignment:
| Q |
20 |
cactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29595600 |
cactggtgagggacttaattgaaccctcacgctagaatccacc |
29595642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 23257357 - 23257319
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23257357 |
ggtgagggacttaattggaccctcactctagaatccacc |
23257319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 24 - 62
Target Start/End: Original strand, 27345929 - 27345967
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27345929 |
ggtgagggacttaattgaaccctcaccctagaatccacc |
27345967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 24565617 - 24565573
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
24565617 |
tccaccggtgagggatttaattgaaccctcaccctagaatccacc |
24565573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 24606653 - 24606609
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
24606653 |
tccaccggtgagggatttaattgaaccctcaccctagaatccacc |
24606609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 63
Target Start/End: Complemental strand, 39936294 - 39936254
Alignment:
| Q |
23 |
tggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39936294 |
tggtgagggacttaattgaaccctcaccttagaatccacct |
39936254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 39937910 - 39937954
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
39937910 |
tccaccggtgagggacttaactgaaccctcaccctagaatccacc |
39937954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 40372164 - 40372208
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
40372164 |
tccaccggtgaggaacttaattgaaccctcaccctagaatccacc |
40372208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 2029057 - 2029096
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
2029057 |
ggtgagggacttaattgagccctcaccctagaatccacct |
2029096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 62
Target Start/End: Original strand, 23253496 - 23253534
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
23253496 |
ggtgagggacttaattggaccctcaccctagaatccacc |
23253534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 35524166 - 35524121
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||| |||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
35524166 |
tccaccggtgagggacttaattgaactctcatcctagaatccacct |
35524121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 39466929 - 39466884
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
39466929 |
tccaccggtgagggacttaattggaccctcaccctagaattcacct |
39466884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 16)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 34941546 - 34941501
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34941546 |
tccactagtgagggacttaattgaaccctcaccctagaatccacct |
34941501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 20 - 62
Target Start/End: Complemental strand, 51386498 - 51386456
Alignment:
| Q |
20 |
cactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
51386498 |
cactggtgagggacttaattgaaccctcaccctaaaatccacc |
51386456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 14527586 - 14527625
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
14527586 |
ggtgagggacttaattgatccctcaccctagaatccacct |
14527625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 63
Target Start/End: Original strand, 13925648 - 13925698
Alignment:
| Q |
13 |
tgtgttccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||| ||||| ||||||||||||| |||| |||||||| |||||||||||| |
|
|
| T |
13925648 |
tgtggtccaccggtgagggacttagttgatccctcactttagaatccacct |
13925698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 24666167 - 24666129
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
24666167 |
ggtgagggacttaattgatccctcaccctagaatccacc |
24666129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 26354243 - 26354281
Alignment:
| Q |
25 |
gtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
26354243 |
gtgagggacttaattgaaccctcaccctagaacccacct |
26354281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 42792813 - 42792775
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
42792813 |
ggtgagggacttaattggaccctcaccctagaatccacc |
42792775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 34450859 - 34450814
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| ||||||| ||||| |
|
|
| T |
34450859 |
tccaccggtgagggacttaattgatccctcaccctagaattcacct |
34450814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 25 - 62
Target Start/End: Complemental strand, 52129458 - 52129421
Alignment:
| Q |
25 |
gtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52129458 |
gtgagggacttaattgaaccctcaccttagaatccacc |
52129421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 6057003 - 6057047
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||||||||||| | |||||||||| |||||||||||| |
|
|
| T |
6057003 |
tccaccggtgagggacttagtagaaccctcaccctagaatccacc |
6057047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 13924837 - 13924793
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
13924837 |
tccaccggtgagggatttaattgagccctcaccctagaatccacc |
13924793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 18363657 - 18363697
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatc |
58 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| |||||||| |
|
|
| T |
18363657 |
tccaccggtgaggaacttaattgaaccctcaccctagaatc |
18363697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 63
Target Start/End: Original strand, 24666865 - 24666901
Alignment:
| Q |
27 |
gagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
24666865 |
gagggacttaattgaaccctcaccctataatccacct |
24666901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 25055145 - 25055109
Alignment:
| Q |
26 |
tgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
25055145 |
tgaggaacttaattgaaccctcaccctagaatccacc |
25055109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 36599271 - 36599231
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatc |
58 |
Q |
| |
|
||||| ||||||| |||||||||||||||||| |||||||| |
|
|
| T |
36599271 |
tccaccggtgaggaacttaattgaaccctcaccctagaatc |
36599231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 47157383 - 47157427
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
47157383 |
tccaccggtgagggatttaattgaaccctcaccctagaattcacc |
47157427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 5312284 - 5312240
Alignment:
| Q |
19 |
ccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
5312284 |
ccactggtgagggacttaattgaaccctcactgtagaattcacct |
5312240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 16718998 - 16719042
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| |||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
16718998 |
tccaccggtgagggacttaattgatccgtcaccctagaatccacc |
16719042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 16)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 20807975 - 20807937
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20807975 |
ggtgagggacttaattgaaccctcaccctagaatccacc |
20807937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 24 - 61
Target Start/End: Complemental strand, 54308491 - 54308454
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccac |
61 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54308491 |
ggtgagggacttaattgaaccctcaccctagaatccac |
54308454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 15287611 - 15287567
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
15287611 |
tccaccggtgagggacttaattggaccctcaccctagaatccacc |
15287567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 53346501 - 53346545
Alignment:
| Q |
19 |
ccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
53346501 |
ccaccggtgagggacttaattgaaccctcactgtagaattcacct |
53346545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 54753620 - 54753576
Alignment:
| Q |
19 |
ccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
54753620 |
ccactggtgagggacttaattgaaccctcaccgtagaattcacct |
54753576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 9830616 - 9830573
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccac |
61 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
9830616 |
tccaccggtgagggacttaattgaaccctcacccgagaatccac |
9830573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 27 - 62
Target Start/End: Original strand, 49350283 - 49350318
Alignment:
| Q |
27 |
gagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49350283 |
gagggacttaattgaaccctcaccctagaatccacc |
49350318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 62
Target Start/End: Original strand, 4706966 - 4707004
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
4706966 |
ggtgagggacttaatagaaccctcaccctagaatccacc |
4707004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 62
Target Start/End: Original strand, 20808617 - 20808655
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
20808617 |
ggtgagggacttacttgaaccctcaccctagaatccacc |
20808655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 47571234 - 47571196
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
47571234 |
ggtgagggacttaattgatccctcaccctagaatccacc |
47571196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 62
Target Start/End: Complemental strand, 49349714 - 49349676
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
49349714 |
ggtgagggacttaattgatccctcaccctagaatccacc |
49349676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 16076254 - 16076209
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||| ||||||||||| |||||| |||||||| ||||||||||||| |
|
|
| T |
16076254 |
tccattggtgagggacctaattggaccctcaccctagaatccacct |
16076209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 60
Target Start/End: Original strand, 48626127 - 48626160
Alignment:
| Q |
27 |
gagggacttaattgaaccctcactctagaatcca |
60 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
48626127 |
gagggacttaattgaaccctcaccctagaatcca |
48626160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 53547 - 53503
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| ||||||||||| |
|
|
| T |
53547 |
tccactggtgagggacttgattgaactctcaccatagaatccacc |
53503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 41419623 - 41419671
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacctgta |
66 |
Q |
| |
|
||||| |||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
41419623 |
tccaccggtgagggacctaattggcccctcacactagaatccacctgta |
41419671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 43454165 - 43454209
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| |||||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
43454165 |
tccacaggtgagggacctaattggaccctcaccctagaatccacc |
43454209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 22632972 - 22633017
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
22632972 |
tccaccggtgagggacttaattgatccctcaccctagaatccacct |
22633017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 26847135 - 26847091
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacctgtaaa |
68 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
26847135 |
ggtgagggacttaattggaccctcaccctagaatccacctctaaa |
26847091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 36403029 - 36403073
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| |||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
36403029 |
tccaccggtgagggacctaattggaccctcactctagaatccacc |
36403073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 22632366 - 22632323
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccac |
61 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
22632366 |
tccaccggtgagggacttaattgatccctcaccctagaatccac |
22632323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 42094047 - 42094008
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
42094047 |
ggtgagggacttaattgatccctcaccctagaatccacct |
42094008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 62
Target Start/End: Original strand, 4402297 - 4402335
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
4402297 |
ggtgagggacttaatagaaccctcaccctagaatccacc |
4402335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 62
Target Start/End: Original strand, 16911056 - 16911094
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
16911056 |
ggtgagggacttaattgagccctcaccctagaatccacc |
16911094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 5434076 - 5434032
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
5434076 |
tccaccggtgaaggacttaattggaccctcaccctagaatccacc |
5434032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 5434781 - 5434817
Alignment:
| Q |
26 |
tgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| |
|
|
| T |
5434781 |
tgagggacttaattggactctcactctagaatccacc |
5434817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 9277786 - 9277830
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
9277786 |
tccattggtgagggacttaattgctccctcaccctagaatccacc |
9277830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 9)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 62
Target Start/End: Complemental strand, 127082 - 127033
Alignment:
| Q |
13 |
tgtgttccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
127082 |
tgtggtccactgatgagggacttagttgaaccctcaccctagaatccacc |
127033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 127745 - 127784
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
127745 |
ggtgaaggacttaattgaaccctcaccctagaatccacct |
127784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 20606931 - 20606970
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
20606931 |
ggtgagggacttaattgaaccctcaccctagaattcacct |
20606970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 69
Target Start/End: Original strand, 24394897 - 24394940
Alignment:
| Q |
26 |
tgagggacttaattgaaccctcactctagaatccacctgtaaaa |
69 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
24394897 |
tgagggacttaattgatcccccactctagaatccacctataaaa |
24394940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 61
Target Start/End: Original strand, 34595944 - 34595981
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccac |
61 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
34595944 |
ggtgagggatttagttgaaccctcactctagaatccac |
34595981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Original strand, 44297424 - 44297457
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaat |
57 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
44297424 |
ggtgagggacttaattgaaccctcaccctagaat |
44297457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 7754971 - 7755015
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||| |||||||||||| ||||||| |||||||||||| |
|
|
| T |
7754971 |
tccaccggtgaaggacttaattgatccctcaccctagaatccacc |
7755015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 10365525 - 10365561
Alignment:
| Q |
32 |
acttaattgaaccctcactctagaatccacctgtaaa |
68 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
10365525 |
acttaattgatccctcaccctagaatccacctgtaaa |
10365561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 18537497 - 18537541
Alignment:
| Q |
18 |
tccactggtgagggacttaattgaaccctcactctagaatccacc |
62 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18537497 |
tccaccggtgagggacttaattgaaccctcatcatagaatccacc |
18537541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0627 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0627
Description:
Target: scaffold0627; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 6502 - 6463
Alignment:
| Q |
24 |
ggtgagggacttaattgaaccctcactctagaatccacct |
63 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
6502 |
ggtgagggacttaattgaaccctcaccctagaacccacct |
6463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University