View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12186_high_7 (Length: 259)
Name: NF12186_high_7
Description: NF12186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12186_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 36603462 - 36603234
Alignment:
| Q |
18 |
cctttccacaacaagaatggattaaactcatcaacatgcctgtgttgataggtgctactggaatgatgccaccagctacagcagtgaattacactagctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36603462 |
cctttccacaacaagaatggattaaactcatcaacatgcctgtgttgataggtgctactggaatgatgccaccagctacagcagtgaattacactagctg |
36603363 |
T |
|
| Q |
118 |
gatcattgttggttttttgtctgggtttgttgtgtataggtataaaccagattggtggcagcgtcataattatgtgttgtctggtgcattggatgctggt |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36603362 |
gatcattgttggttttttgtctggttttgttgtgtataggtataagccagaatggtggcagcgtcataattatgtgttgtctggtgcattggatgctggt |
36603263 |
T |
|
| Q |
218 |
cttgctttcatgggtgtggttttgtacct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36603262 |
cttgctttcatgggtgtggttttgtacct |
36603234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University