View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12186_low_8 (Length: 226)
Name: NF12186_low_8
Description: NF12186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12186_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 37221386 - 37221190
Alignment:
| Q |
14 |
aagcaaaggtgggtccgatccaaataattgagcagtgtgaatggaatagaatgattgctgccaccccaactcataggtcattaacatcgagagtacagtg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
37221386 |
aagcaaaggtgggtccgatccaaataattgagcagtgtgaatggaatagaatgattgctgccaccccaactcataagtca-taacatcgagagtacagtg |
37221288 |
T |
 |
| Q |
114 |
cattatacttggaatatgggtcgtgtgaaggagaataaatgaagaagtagcttccagttttgcaggttgcagtgtgaaaggatcaatgcaccatgcttgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37221287 |
cattatacttggaatatgggtcgtgtgaag--gaataaatgaagaagtagcttccagttttgcaggttgcagtgtgaaaggatcaatgcaccatgcttgt |
37221190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University