View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12187_high_3 (Length: 335)
Name: NF12187_high_3
Description: NF12187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12187_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 22 - 298
Target Start/End: Complemental strand, 1316908 - 1316628
Alignment:
| Q |
22 |
aaaaaagcaattttcttcgttctcttgttaatcaactcttcttatatatgggcttcttgataaagtataggagtaattttttagctatttcttttacacc |
121 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1316908 |
aaaaaagcaattttcttcattctcttgttaatcaactcttcttatatatgggcttcttgataaagtataggagtaattttttagctatttcttttacacc |
1316809 |
T |
 |
| Q |
122 |
tccgttttt-cttgtgtgctctattcaaattataaaattcaaaaaataaatgaaga---gtttttgaaggtatttaaacgtgttttagaagatttagaaa |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1316808 |
tccgtttttgcttgtgtgctctattcaaattataaaattcaaaaaataaatgaagaagagtttttgaaggtatttaaacgtgttttagaagatttagaaa |
1316709 |
T |
 |
| Q |
218 |
cattaatatttttcgaattataaagttcaaagttcgcagggaaaataaaaaactaattggatggaaaaagaagacaaacaa |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1316708 |
cattaatatttttcgaattataaagttcaaagttcgcagggaaaataaaaaactaattggatggaaaaagaagacaaacaa |
1316628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University