View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12187_high_6 (Length: 284)
Name: NF12187_high_6
Description: NF12187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12187_high_6 |
 | |
|
| [»] scaffold0044 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0044 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 12 - 261
Target Start/End: Complemental strand, 55601 - 55332
Alignment:
| Q |
12 |
aacctgtgacatatatgagaaaggatggatcagtgagatgtatggatactcttttggtgctgcggaggtgagttttcactctcgaaatggttttttatct |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
55601 |
aaccggtgacatatatgagaaaggatggatcagtgagatgtatggatactcttttggtgctgcagaagtgagttttcactctcgaaatggttttttatct |
55502 |
T |
|
| Q |
112 |
caagaattatatcccctccgtaataaaataagtaaaaaactacttgtattcggttt--------------------ttcatctggcgctacatttctagt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55501 |
caagaattatatcccctccgtaataaaataagtaaaaaactacttgtattcggtttttttatacatagtgaccatattcatctggcgctacatttctagt |
55402 |
T |
|
| Q |
192 |
ttttgaactatttaactttcactaactgttttcctttttaccttcttctttctaataatttcctttcaat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55401 |
ttttgaactatttaactttcactaactgttttcctttttaccttcttctttctaataatttcctttcaat |
55332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 7785178 - 7785113
Alignment:
| Q |
19 |
gacatatatgagaaaggatggatcagtgagatgtatggatactcttttggtgctgcggaggtgagt |
84 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||| |||||||||||||||||||| || |||||| |
|
|
| T |
7785178 |
gacatctatgggaaaggatggatcagtgagatgtacggatactcttttggtgctgcagaagtgagt |
7785113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 7782866 - 7782805
Alignment:
| Q |
19 |
gacatatatgagaaaggatggatcagtgagatgtatggatactcttttggtgctgcggaggt |
80 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||| ||||| |||||||| || ||||| |
|
|
| T |
7782866 |
gacatatatgaatcagggtggatcagtgagatgtatgggtactcatttggtgcggctgaggt |
7782805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University