View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12187_low_10 (Length: 214)
Name: NF12187_low_10
Description: NF12187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12187_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 1329358 - 1329176
Alignment:
| Q |
15 |
cagagacaagagattaatatcaaaagcataacaaaaatattacaattgagttcactgccactttatcatgcagcagattctaaattactggtttcttttg |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329358 |
cagaaacaagagattaatatcaaaagcataacaaaaatattacaattgagttcactgccactttatcatgcagcagattctaaattactggtttcttttg |
1329259 |
T |
|
| Q |
115 |
aagttccacagacttgcaattgcgagcattcaataaagataaaataccatgcttacaactggaatggatagaagaacattatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1329258 |
aagttccacagacttgcaattgcgagcattcaataaagataaaataccatgcttacaattggaatggatagaagaacattatg |
1329176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 86
Target Start/End: Complemental strand, 44188144 - 44188073
Alignment:
| Q |
15 |
cagagacaagagattaatatcaaaagcataacaaaaatattacaattgagttcactgccactttatcatgca |
86 |
Q |
| |
|
|||| ||||||||||| | ||||||||| ||||||||||| ||| ||||||||||||| ||||||||||| |
|
|
| T |
44188144 |
cagaaacaagagattagtgtcaaaagcagaacaaaaatatcacagctgagttcactgcccttttatcatgca |
44188073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 143 - 192
Target Start/End: Complemental strand, 44187976 - 44187927
Alignment:
| Q |
143 |
ttcaataaagataaaataccatgcttacaactggaatggatagaagaaca |
192 |
Q |
| |
|
||||||||||| ||||||| |||||||||| |||||| || ||||||||| |
|
|
| T |
44187976 |
ttcaataaagacaaaatactatgcttacaattggaatcgaaagaagaaca |
44187927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University