View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12187_low_11 (Length: 207)
Name: NF12187_low_11
Description: NF12187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12187_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 84 - 187
Target Start/End: Original strand, 17406836 - 17406939
Alignment:
| Q |
84 |
ttatgaatgctatttaacatagatgcaaaggagaaaacatacagagcaagaacatcaaagtttttggcgagaacttgaagcaaattgttgccagaagcac |
183 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17406836 |
ttatcaatggtatttaacatagatgcaaaggagaaaacatacagagcaagaacatcaaagtttttggcgagaacttgaagcaaattgttgccagaagcac |
17406935 |
T |
|
| Q |
184 |
ccat |
187 |
Q |
| |
|
|||| |
|
|
| T |
17406936 |
ccat |
17406939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University