View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12187_low_8 (Length: 257)
Name: NF12187_low_8
Description: NF12187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12187_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 3688511 - 3688694
Alignment:
| Q |
1 |
ctcgagaccggagacctgaagccggaatgtgagcaggtgtttaaaagggagaagacggagattgttgacggtgttgtttcttggatgacaccgtttcagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
3688511 |
ctcgagaccggagacctgaagccggaatgtgagcaggtgtttaaaagggagaagacggatattgttgacggtgttgtttcgtggatgacaccgttacagg |
3688610 |
T |
|
| Q |
101 |
ttgttcaaccgccgcaacaatatgaaacattgcggtatggatcatcattaccgttttcgtttgggagtgagaagaatgagggaa |
184 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| ||| ||| ||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
3688611 |
ttgttcaacggccgcaacaatatgaaactttgcggtatagattatcgttaccattttcgtttgggagtgaaaagaatgaaggaa |
3688694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 181 - 239
Target Start/End: Original strand, 3688727 - 3688785
Alignment:
| Q |
181 |
ggaaaagtgaaatctaatgggtcttctaggtgttcttctgctatttctgattatcaaag |
239 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3688727 |
ggaaaagtcaaatctaatgggtcttctaggtgttcttctgctatttctgattatcaaag |
3688785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University