View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12188_high_11 (Length: 316)
Name: NF12188_high_11
Description: NF12188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12188_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 18 - 301
Target Start/End: Complemental strand, 32096503 - 32096220
Alignment:
| Q |
18 |
tgtggaagagtgtggagccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattgagagtgatgctttgttggagatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096503 |
tgtggaagagtgtggagccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattgagagtgatgctttgttggagatt |
32096404 |
T |
|
| Q |
118 |
gagtgtttgcatagagaaggattgttgcttgatgttatggtaatgttgagggagttgaggattgaggttattggagttcaatcttcgcttaataatggtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096403 |
gagtgtttgcatagagaaggattgttgcttgacgttatggtaatgttgagggagttgaggattgaggttattggagttcaatcttcgcttaataatggtg |
32096304 |
T |
|
| Q |
218 |
tttttgttgcggagttgagggctaaggtgaaggaaaatggtggaaatgggaagaaagttagtattgttgaagttaagagagcac |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32096303 |
tttttgttgcggagttgagggctaaggtgaaggaaaatggtggaaatgggaagaaagttagtattgtggaagttaagagagcac |
32096220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University