View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12188_high_4 (Length: 429)
Name: NF12188_high_4
Description: NF12188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12188_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 13 - 411
Target Start/End: Complemental strand, 33543598 - 33543200
Alignment:
| Q |
13 |
ctgtgttgcaaaaatctgtggagttattccaattgcttaaagctgaaggaaaattcaattgttgttgaattcttaggagggtttgagtgtgtgaggattg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33543598 |
ctgtgttgcaaaaatctgtggagttattccaattgcttaaagctgaaggaaaattcaattgttgttgaattcttaggagggtttgagtgtgtgaggattg |
33543499 |
T |
|
| Q |
113 |
aagctgttctgaatgatttatagaaagtaaaatagtaaccaaaacaaaaaacacagataccatagnnnnnnnnnnnnnnnnnnnnattatattctacaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | | |
|
|
| T |
33543498 |
aagctgttctgaatgatttatagaaagtaaaatagtaaccaaaacaaaaaacacagataccatagtgtttttgttttgttttgttattatattctaaaga |
33543399 |
T |
|
| Q |
213 |
agcattggagttctctcaaaattgaagccttgaaacacaagcagaaaccctgcaattacaagaagttatgttaccttaaacaaacataattttttcgcaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33543398 |
agcattggagttctctcaaaattgaagccttgaaacacaagcagaaaccctgcaattacaagaagttatgttaccttaaacaaacataattttttcgcaa |
33543299 |
T |
|
| Q |
313 |
gaatcaactgaattcaagcattataactcaacactatgaaattcattatttcacaggaaaccaacaaaaagtacaagaaaagttcaatcataacgaaat |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33543298 |
gaatcaactgaattcaagcattataactcaacactatgaaattcattatttcacaggaaaccaacaaaaagtacaagaaaagttcaatcataacaaaat |
33543200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University