View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12188_low_14 (Length: 290)
Name: NF12188_low_14
Description: NF12188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12188_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 19754963 - 19755216
Alignment:
| Q |
18 |
gaagactctgtgtcagtatttgaagggaggatattaccaaccaacataagatcaagggcctcaaaagggtcacgttctttcagcacatcaaactcctctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19754963 |
gaagactctgtgtcagtatttgaagggaggatattaccaaccaacataagatcaagggcctcaaaagggtcacgttctttcagcacatcaaactcctctt |
19755062 |
T |
 |
| Q |
118 |
gacttatagtcacagtggtagaatttgtcactggagtaggagattttgtctttggagaatcttgtttagattcatctttagattctttgacatattcttt |
217 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19755063 |
gacttattgtcacactggtagaatttgtcactcgagtaggagattttgtctttggagaatcttgtttagattcatctttagattctttgacatattcttt |
19755162 |
T |
 |
| Q |
218 |
acgaccttccccatcagtgtcagtgtgctttgtatcatcttcagagttcaaccc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19755163 |
acgaccttccccatcagtgtcagtgtgctttgtatcatcttcagagttcaaccc |
19755216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University