View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12188_low_15 (Length: 289)
Name: NF12188_low_15
Description: NF12188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12188_low_15 |
 | |
|
| [»] scaffold1099 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1099 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: scaffold1099
Description:
Target: scaffold1099; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 21 - 277
Target Start/End: Original strand, 1870 - 2126
Alignment:
| Q |
21 |
atccagacattcagaaggtggaagcgagaattgctattccttggatcatcccctccaccaacagctttacaactacatcaatcagcaagctagactccgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1870 |
atccagacattcagaaggtggaagcgagaattgctattccttggatcatcccctccaccaacagctttacaactacatcaatcagcaagctagactccgt |
1969 |
T |
|
| Q |
121 |
gaagctgttgcacccatcaagcagggatcatttcatgtggattttccagaacctccggatgtggatacaaggattgccaagactatagagtcagggtttg |
220 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1970 |
gaagctgttgcacccatcaagcaaggatcatttcatgtggattttccagaacctccggatgtggatacaaggattgccaagactatagagtcagggtttg |
2069 |
T |
|
| Q |
221 |
atagcctaaccttgaatggaaataaggaacgattgaacaattggactggagcacagg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2070 |
atagcctaaccttgaatggaaataaggaacgattgaacaattggactggagcacagg |
2126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 9885895 - 9885843
Alignment:
| Q |
49 |
aattgctattccttggatcatcccctccaccaacagctttacaactacatcaa |
101 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||| | || |||||||||||||| |
|
|
| T |
9885895 |
aattgctattccttggatcaccccttccatcaagaactctacaactacatcaa |
9885843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University