View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12188_low_16 (Length: 285)
Name: NF12188_low_16
Description: NF12188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12188_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 9 - 133
Target Start/End: Complemental strand, 40819999 - 40819875
Alignment:
| Q |
9 |
gagaagaaaatgtcagtgtaacccctaaaaagcttggaaaaataatactactgagaagttaagaacaaagaatattggacaaaagaaacagattatcacc |
108 |
Q |
| |
|
|||||| || ||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40819999 |
gagaaggaagtgtaagtgtaacccctaaaaagcttggaaaaataataccactgagaagttaagaacaaagaatattggacaaaagaaacagattatcacc |
40819900 |
T |
|
| Q |
109 |
agatcttacaggaacattgtagtgt |
133 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40819899 |
agatcttacaggaacattgtagtgt |
40819875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 40819830 - 40819783
Alignment:
| Q |
182 |
ttccatcatcagaattcagaaagtaagctgtgtgcatccattactatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40819830 |
ttccatcatcagaattcagaaagtaagctgtgtgcatccattactatg |
40819783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University