View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12188_low_20 (Length: 240)
Name: NF12188_low_20
Description: NF12188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12188_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 17 - 228
Target Start/End: Complemental strand, 33935620 - 33935403
Alignment:
| Q |
17 |
aaatggaaa-atgtgtccttgaagcctttacattggaagaaaata----gaagagaaaagaaaaaggtgtaagtaatttagtagaaacatatgtcaaagc |
111 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33935620 |
aaatggaaagatgtgtgcttgaagcctttacattggaagaaaataaattgaagagaaaggaaaaaggtgtaagtaatttagtagaaacatacgtcaaagc |
33935521 |
T |
 |
| Q |
112 |
aagggtcgttttgtccttttg---nnnnnnntagaaattcattcttcactttctttccaatcttgcaggaagggggtgaagttagcaataacaatggagt |
208 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
33935520 |
aagggtcgatttgtccttttgaaagaaaaaaaagaaattcattcttcactttccttccaatcttggaggaa--gggtgaagctagcaataacaatggagt |
33935423 |
T |
 |
| Q |
209 |
agttttggttatccaaaaga |
228 |
Q |
| |
|
||||||||||| || ||||| |
|
|
| T |
33935422 |
agttttggttacccgaaaga |
33935403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University