View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12188_low_22 (Length: 231)
Name: NF12188_low_22
Description: NF12188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12188_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 11 - 217
Target Start/End: Original strand, 39878914 - 39879120
Alignment:
| Q |
11 |
gagcagagagggacccttgaggttgagagtgactggtgagactgnnnnnnncacagacctcttcttcaatttctgtttatccctctcatcttctcaacta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
39878914 |
gagcagagagggacccttgaggttgagagtgactggtgagactgaaaaaaacacagacctcttcttctatttctgtttatccatctcatcttctcaacta |
39879013 |
T |
 |
| Q |
111 |
attttactgcccactattttccattattatcattctttcattgtcattttttggacaaatatgtcacaatattaaatgctccctttcatcctttctttcc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||| | ||||||||||| |
|
|
| T |
39879014 |
attttactgcccactattttccattattatctttctttcattgtcattttttggacaaatatgtcacaatattaaatgttctctttgaccctttctttcc |
39879113 |
T |
 |
| Q |
211 |
cttgatg |
217 |
Q |
| |
|
||||||| |
|
|
| T |
39879114 |
cttgatg |
39879120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University