View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12189_high_12 (Length: 209)
Name: NF12189_high_12
Description: NF12189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12189_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 100 - 199
Target Start/End: Original strand, 40962314 - 40962413
Alignment:
| Q |
100 |
caatactactcttaaacccttcaaattcaatctctcatcttctttcattcaaccatctctttatcatcacacttcttctcccttcactgtctctgcttct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40962314 |
caatactactcttaaacccttcaaattcaatctctcatcttctttcattcaaccatctctttatcatcacacttcttctcccttcactgtctcagcttct |
40962413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University