View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12189_high_14 (Length: 204)
Name: NF12189_high_14
Description: NF12189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12189_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 78 - 186
Target Start/End: Original strand, 54650963 - 54651071
Alignment:
| Q |
78 |
ttaattctttacagcaactaattttaatttatgttctacttttttggtgatagattatatctgcatgtctctctgaaaccttgtttggcatgtcccacac |
177 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54650963 |
ttaattctttacaacaactaattttaatttatgttctacttttttggtgatagattatatctgcatgtctctctgaaaccttgtttggcatgtcccacac |
54651062 |
T |
 |
| Q |
178 |
cgttaaaac |
186 |
Q |
| |
|
||||||||| |
|
|
| T |
54651063 |
cgttaaaac |
54651071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University