View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12189_high_8 (Length: 245)
Name: NF12189_high_8
Description: NF12189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12189_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 39 - 208
Target Start/End: Complemental strand, 10236273 - 10236104
Alignment:
| Q |
39 |
agtgaattgattcatacagctcttgatgaagaatgaatcgaatcaaattgtacacaagaaaatgtttgatttaattcatagcttccaaaaatgatttgat |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||| ||||||||||||| ||||||| |
|
|
| T |
10236273 |
agtgaattgattcatacagctcttgatgaagaatgaatcaaatcaaactgtacacaagaaaatgtttgattcgattcacagcttccaaaaataatttgat |
10236174 |
T |
 |
| Q |
139 |
atgaatcagaggaatttaaatcgattcaattatcatgaacccgaaacccgagaatctgaatgaatcaatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
10236173 |
atgaatcagaggaatttaaatcgattcaattatcatgaacccaaaacccaagaatctgaatgaatcaatt |
10236104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University