View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12189_low_15 (Length: 209)

Name: NF12189_low_15
Description: NF12189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12189_low_15
NF12189_low_15
[»] chr5 (1 HSPs)
chr5 (100-199)||(40962314-40962413)


Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 100 - 199
Target Start/End: Original strand, 40962314 - 40962413
Alignment:
100 caatactactcttaaacccttcaaattcaatctctcatcttctttcattcaaccatctctttatcatcacacttcttctcccttcactgtctctgcttct 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
40962314 caatactactcttaaacccttcaaattcaatctctcatcttctttcattcaaccatctctttatcatcacacttcttctcccttcactgtctcagcttct 40962413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University