View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12189_low_3 (Length: 474)
Name: NF12189_low_3
Description: NF12189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12189_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 10910810 - 10911029
Alignment:
| Q |
18 |
caaaccaaagcttaacatcttcattgcagtggctgctatgctgtggtctttgatgtgagttttgctttggtctatcacaagcacaataactagttctaca |
117 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10910810 |
caaaccaaagcttgacatcttcattgtagtggctgctatgttgtggtctttgatgtgagttttgatttggtctatcacaagcacaataactagttctaca |
10910909 |
T |
|
| Q |
118 |
catctattgtaatactcctttcatgctctacaagttactgatcatacttaaactgattggtcaaggcagcaatactttaatgcctgtattaggtgtcttg |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
10910910 |
catttattgtaatactcctttcatgctctacaagttactgatcatacttaaactgattggtcaa-gcagtaatactttaatgcctgtattaggtgtcttg |
10911008 |
T |
|
| Q |
218 |
tgcatgccgtgtttatgaatg |
238 |
Q |
| |
|
||||| |||||||| |||||| |
|
|
| T |
10911009 |
tgcataccgtgtttttgaatg |
10911029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 345 - 474
Target Start/End: Original strand, 10911542 - 10911671
Alignment:
| Q |
345 |
aaacaagggatcaaaggaacctactgagagactgatattggtcttcaagcttcccaagtggcttagagaccataagcttccataatttgaaccataacga |
444 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10911542 |
aaacaagggaacaaaggaacctactgagagactgatattggtcttcaaacttcccaagtgggttagagaccataagcttccataatttgaaccataacga |
10911641 |
T |
|
| Q |
445 |
ttttccacaaacattttttattataaactt |
474 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10911642 |
ttttccacaaacattttttattataaactt |
10911671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University