View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12189_low_4 (Length: 441)
Name: NF12189_low_4
Description: NF12189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12189_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 18 - 431
Target Start/End: Original strand, 23867587 - 23867997
Alignment:
| Q |
18 |
gttattactacaattttccgacacactcactaacccattgtttcattcatcctcgtactttccaaatcctcaaaaacttcaaaaatgaataagttgtttt |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23867587 |
gttattgctacaattttccgacacactcactaacccattgtttcattcatcctcgtattttccaaatcctcaaaaacttcaaaaatgaataagttgtttt |
23867686 |
T |
 |
| Q |
118 |
cactctttgtactttcaatgttctttacagttttgtttgcacagaatgctccggcttcttctcctaagtcatcaattacagcgaaaccaccgtcttcggt |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| || |
|
|
| T |
23867687 |
cactctttgtactttcaatgttatttacagttttgtttgcacagaatgctccggcttcttctcctaagtcatcggttacggcgaaaccaccgtcttccgt |
23867786 |
T |
 |
| Q |
218 |
ttcagtttctccgacaaattctccggcatcccctgcaaagtctccaactttatctccgccttcacaaactccggcggtttctccatctgggtctgcgtct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23867787 |
ttcagtttctccgacaaattctccggcatcccctgcaaagtctccaactttatctccgccttcacaaactccggcggtttctccatctgggtctgcgtct |
23867886 |
T |
 |
| Q |
318 |
accccaccgccggcaacagccccaccggcgaagtctccggctgttcagccaccgtcttcttcggtttcaccagcaatcagtccttccaacaatgtgtctt |
417 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23867887 |
accccaccgccggcaacatccccaccggcgaagtctccggctgttcagccaccg---tcttcggtttcaccagcaatcagtccttccaacaatgtgtctt |
23867983 |
T |
 |
| Q |
418 |
ccacaccacaggtt |
431 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
23867984 |
ccacaccaccggtt |
23867997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University