View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12190_high_2 (Length: 290)
Name: NF12190_high_2
Description: NF12190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12190_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 4738742 - 4738644
Alignment:
| Q |
17 |
agaattgaaagaaagagacgatcaacgca-gttacaagttacactctgaagatacaaataattttgctcaaaatactagtggaaattaatttataaaaa |
114 |
Q |
| |
|
||||||||||||||||| ||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4738742 |
agaattgaaagaaagaggcgatcaaagcaagttacaagttacactcttaagatacaaataattttgctcaaaatattagtggaaattaatttataaaaa |
4738644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 220 - 275
Target Start/End: Complemental strand, 4736708 - 4736653
Alignment:
| Q |
220 |
tttttagggcacaaaatatgatcgttgtgggtagaatttagctaggacgaatcaca |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4736708 |
tttttagggcacaaaatatgatcgttgtgggtagaatttagctaggacgaatcaca |
4736653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 228
Target Start/End: Complemental strand, 4738503 - 4738475
Alignment:
| Q |
200 |
atagttcttgacaaatgacctttttaggg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4738503 |
atagttcttgacaaatgacctttttaggg |
4738475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University