View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12191_high_3 (Length: 227)
Name: NF12191_high_3
Description: NF12191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12191_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 51454847 - 51454641
Alignment:
| Q |
17 |
caaacatataaaaatgaacagagtgatgatcatgtaatgttaccttagcattactctccctgattttaagtttcttgtggacttgtggaacctcattttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51454847 |
caaacatataaaaatgaacagagtgatgatcatgtaatgttaccttagcattactctccctgattttaagtttcttgaggacttgtggaacctcattttt |
51454748 |
T |
 |
| Q |
117 |
ggtggtttccttctccgcctttatctttctgccgcgtctctttctcaccagttgaaatgatgaagagcccccggcatcattatcaccttcaccagcttct |
216 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51454747 |
ggtggtttccttctccacctttctctttctgccgcgtctctttctcaccggttgaaatgatgaagagccgccggcatcattatcaccttcaccagcttct |
51454648 |
T |
 |
| Q |
217 |
tcctttg |
223 |
Q |
| |
|
||||||| |
|
|
| T |
51454647 |
tcctttg |
51454641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 99 - 185
Target Start/End: Complemental strand, 43160133 - 43160047
Alignment:
| Q |
99 |
ttgtggaacctcatttttggtggtttccttctccgcctttatctttctgccgcgtctctttctcaccagttgaaatgatgaagagcc |
185 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||| |||||||||||| | |||||||| || ||||||||||||||||||| |
|
|
| T |
43160133 |
ttgtggaacctcattttcggtggtttccttctccgattttctctttctgccgcatttctttctctccggttgaaatgatgaagagcc |
43160047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University