View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12192_high_5 (Length: 212)

Name: NF12192_high_5
Description: NF12192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12192_high_5
NF12192_high_5
[»] chr4 (1 HSPs)
chr4 (13-193)||(2916733-2916913)


Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 2916913 - 2916733
Alignment:
13 cacagaccacaacacaacaaaaacactctaccattgaatcttcctacttttaattacaaaaatatccacttttttcaccctgttttatattttaaagaat 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2916913 cacacaccacaacacaacaaaaacactctaccattgaatcttcctacttttaattacaaaaatatccacttttttcaccctgttttatattttaaagaat 2916814  T
113 taatatttgaaacagaaaattcaatgatatcaatgagtggtttggtaattaaaaatgaaaatagacatgaaacaaaaatgg 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2916813 taatatttgaaacagaaaattcaatgatatcaatgagtggtttggtaattaaaaatgaaaatagacatgaaacaaaaatgg 2916733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University