View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12193_low_6 (Length: 291)
Name: NF12193_low_6
Description: NF12193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12193_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 11 - 272
Target Start/End: Original strand, 13309020 - 13309281
Alignment:
| Q |
11 |
cagagaatgaaatatgttgctcttttattttactattgttgttgcaatggttctgctccctaataatgtatacacaaaagttatgaattattatgatata |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13309020 |
cagagaatgaaatatgttgctcttttattttactatttttgttgcaatggttctgctccctaataatgtatacacaaaagttatgaatgattatgatata |
13309119 |
T |
|
| Q |
111 |
tgatccatttatcctagtgatagtaacttagtaagtacttcacttgatctatatgcttcctccgtcctaaattataagtcgatgnnnnnnncaatttcct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
13309120 |
tgatccatttatcctagtgatagtaacttagtaagtacttcacttgatctatatacttcctccgtcctaaattataagccgatgaaaaaaacaatttcct |
13309219 |
T |
|
| Q |
211 |
gattaaaccaatccttctaataggtttgttttgttaactttagaacaaacttcctcaccatt |
272 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13309220 |
gattaaacctatccttctaataggtttgttttgttaactttagaacaaacttcctcaccatt |
13309281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University